I’ve trimmed my seqs by hand in the past but wanted to increase throughput so I’m trying to use trim.seqs this time. I’ve got ~60 sanger sequences of AOA amoA and used the 2005 Francis et al primers. Thus my oligos file looks like this:
forward STAATGGTCTGGCTTAGACG
#reverse GCGGCCATCCATCTGTATGT
When I run trim.seqs(fasta=fasta.filename,oligos=oligo.filename) it runs but all sequences go to the scrap file and none to trim. Most of my sequences definitely have the forward and reverse primers in them as a search with alignment software shows.
My understanding is that this should work, but like I said it’s my first time using Mothur for this operation so maybe I misunderstood trim.seqs capabilities.
I tried this on v1.24 and then updated to v1.26 and am still having the problem. I’ve run it with and without the reverse seq #'ed out, but it doesn’t work either way.
Any ideas on what I might be doing wrong?