Problem of trim.flows command

Commands in mothur
1

Hi,

I have a problem when I tried to run trim.flows command: my .flow file is 1.19 GB, and the .scrap.flow file generated from this step is about 900 GB, and it is still increasing, and this command is still running. I am not sure if this is normal? I am worried that if this file size continuously goes up, the hard drive of my computer will not be enough, and I will not be able to finish this step.

The command I used: mothur > trim.flows(flow=seq.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8)
The oligos file I used:
Forward ACTCCTACGGGAGGCAGCAG
#Reverse CCGTCAATTCMTTTRAGT
barcode TTGGCGTA L1-6
barcode TGCTGTTC L1-12
barcode TGAGGTGA L1-18
…

Anyone have any idea about this?

Thank you in advance!

2

can you tell us what the first line of seq.flow has on it?

3

Thank you for your reply!

This is the first and second line of seq.flow:
800
HPM5JEW01BLYM2 144 1.11 0.00 0.97 0.00 0.00 0.96 0.12 0.58 1.66 0.31 1.11 1.16 0.56 1.76 0.34 1.17 0.03 0.71 0.90 0.35 0.01 0.94 …

4

Sorry - can you post the entire second line? also, are you sure about your file sizes being GB and not MB?

5

Thank you for your reply!

I checked the size of my files again, and I am sure they are GB, not MB. This make me feel very confused. Yesterday I found that the seq.scrap.flow file is over 900 GB, and there is no space in my D drive anymore, but mothur was still running. I removed about 15 MB files (that’s all I could remove from D drive) yesterday to give it more space to keep on running, but I found that the size of that seq.scrap.flow file didn’t increase after that. Now mothur is still running, but it is giving out negative numbers. For example, when the command trim.flows started it was like this:
mothur > trim.flows(flow=seq.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8)
10000
20000
…
Now it is like:
-2431420000
-2431410000
-2431400000
…

I am not sure if this is normal?

----------------------------------------------------------The first several lines of seq.flow file are showed below----------------------------------------------------------------
800
HPM5JEW01BLYM2 144 1.11 0.00 0.97 0.00 0.00 0.96 0.12 0.58 1.66 0.31 1.11 1.16 0.56 1.76 0.34 1.17 0.03 0.71 0.90 0.35 0.01 0.94 1.00 0.00 0.70 0.20 1.01 0.01 0.43 0.48 1.04 1.03 0.30 0.81 1.03 0.98 0.33 0.58 0.96 1.07 0.16 0.88 0.57 1.11 0.14 0.47 1.09 0.91 0.00 1.22 0.69 1.00 0.01 0.65 1.08 0.80 0.04 1.07 1.14 0.61 0.00 1.12 1.09 0.43 0.00 1.12 0.82 1.27 0.03 1.21 0.42 1.17 0.27 1.12 0.29 1.13 0.23 0.99 0.11 1.06 0.26 0.68 0.11 0.89 0.29 0.70 0.21 0.90 0.20 0.72 0.29 0.73 0.15 0.53 0.25 0.58 0.10 0.50 0.23 0.65 0.15 0.39 0.25 0.50 0.17 0.33 0.42 0.61 0.08 0.56 0.35 0.46 0.12 0.40 0.32 0.42 0.06 0.41 0.49 0.29 0.07 0.56 0.62 0.32 0.02 0.84 0.44 0.90 0.04 0.85 0.39 0.80 0.19 0.78 0.33 0.76 0.16 0.68 0.27 0.80 0.16 0.65 0.08 0.70 0.13 0.49 0.18 0.51 0.12 0.46 0.22 0.38 0.12 0.28 0.12 0.31 0.14 0.30 0.09 0.39 0.12 0.22 0.11 0.24 0.12 0.22 0.14 0.29 0.13 0.30 0.11 0.20 0.15 0.22 0.12 0.18 0.13 0.17 0.16 0.15 0.11 0.20 0.17 0.13 0.12 0.22 0.13 0.19 0.11 0.24 0.10 0.21 0.11 0.26 0.12 0.19 0.08 0.25 0.07 0.20 0.08 0.18 0.02 0.20 0.08 0.12 0.05 0.19 0.06 0.14 0.07 0.19 0.06 0.15 0.08 0.17 0.06 0.13 0.05 0.17 0.06 0.13 0.05 0.16 0.07 0.14 0.08 0.15 0.06 0.14 0.07 0.13 0.05 0.15 0.06 0.12 0.04 0.15 0.08 0.11 0.05 0.16 0.08 0.09 0.04 0.17 0.08 0.13 0.05 0.11 0.07 0.13 0.04 0.11 0.06 0.10 0.03 0.13 0.08 0.09 0.05 0.09 0.06 0.10 0.02 0.07 0.07 0.11 0.02 0.08 0.10 0.10 0.00 0.06 0.08 0.08 0.01 0.07 0.08 0.07 0.01 0.07 0.08 0.08 0.02 0.04 0.10 0.12 0.02 0.06 0.08 0.12 0.02 0.05 0.06 0.09 0.02 0.08 0.06 0.10 0.03 0.07 0.05 0.11 0.03 0.08 0.05 0.12 0.02 0.07 0.05 0.11 0.05 0.08 0.03 0.10 0.10 0.08 0.03 0.10 0.08 0.09 0.01 0.13 0.07 0.08 0.03 0.10 0.08 0.11 0.01 0.10 0.08 0.07 0.02 0.10 0.09 0.08 0.00 0.12 0.08 0.11 0.01 0.11 0.07 0.06 0.02 0.11 0.06 0.05 0.01 0.13 0.07 0.03 0.02 0.14 0.05 0.02 0.03 0.14 0.07 0.06 0.03 0.11 0.07 0.04 0.04 0.12 0.06 0.07 0.03 0.11 0.05 0.04 0.01 0.09 0.05 0.04 0.02 0.09 0.04 0.03 0.02 0.10 0.03 0.06 0.02 0.10 0.03 0.08 0.04 0.09 0.04 0.04 0.05 0.08 0.04 0.06 0.04 0.08 0.04 0.06 0.05 0.07 0.04 0.05 0.06 0.07 0.04 0.05 0.03 0.07 0.04 0.05 0.05 0.06 0.04 0.06 0.03 0.06 0.06 0.05 0.03 0.07 0.06 0.05 0.03 0.06 0.06 0.04 0.04 0.07 0.05 0.04 0.04 0.07 0.06 0.04 0.04 0.07 0.07 0.04 0.04 0.06 0.06 0.04 0.04 0.06 0.05 0.02 0.01 0.08 0.06 0.03 0.02 0.08 0.06 0.01 0.02 0.08 0.07 0.01 0.00 0.07 0.05 0.02 0.00 0.10 0.04 0.05 0.00 0.09 0.05 0.05 0.00 0.11 0.04 0.04 0.00 0.10 0.04 0.03 0.00 0.10 0.05 0.03 0.00 0.12 0.06 0.03 0.00 0.12 0.05 0.04 0.00 0.10 0.06 0.01 0.00 0.10 0.07 0.04 0.00 0.09 0.06 0.02 0.00 0.10 0.06 0.03 0.00 0.09 0.05 0.04 0.00 0.09 0.04 0.02 0.00 0.10 0.04 0.05 0.00 0.08 0.04 0.05 0.00 0.07 0.04 0.05 0.00 0.07 0.05 0.02 0.00 0.07 0.05 0.03 0.00 0.07 0.05 0.04 0.00 0.06 0.04 0.07 0.00 0.07 0.04 0.07 0.00 0.07 0.04 0.07 0.00 0.07 0.03 0.07 0.00 0.06 0.02 0.06 0.00 0.06 0.02 0.07 0.00 0.07 0.02 0.07 0.00 0.07 0.02 0.04 0.00 0.08 0.02 0.03 0.02 0.09 0.01 0.04 0.02 0.07 0.02 0.03 0.03 0.08 0.01 0.02 0.07 0.07 0.02 0.04 0.05 0.06 0.03 0.01 0.05 0.05 0.02 0.02 0.05 0.05 0.01 0.01 0.05 0.03 0.02 0.03 0.04 0.04 0.02 0.01 0.05 0.03 0.02 0.02 0.06 0.04 0.02 0.00 0.05 0.04 0.01 0.00 0.05 0.03 0.01 0.00 0.05 0.02 0.01 0.01 0.03 0.05 0.01 0.01 0.03 0.06 0.01 0.01 0.03 0.07 0.01 0.02 0.02 0.07 0.01 0.02 0.01 0.08 0.02 0.03 0.01 0.06 0.01 0.04 0.02 0.06 0.01 0.06 0.01 0.06 0.01 0.06 0.02 0.06 0.02 0.07 0.01 0.06 0.02 0.05 0.00 0.07 0.04 0.05 0.02 0.06 0.03 0.04 0.03 0.07 0.03 0.04 0.03 0.07 0.04 0.04 0.04 0.05 0.04 0.04 0.06 0.05 0.03 0.06 0.05 0.04 0.02 0.05 0.06 0.03 0.02 0.07 0.06 0.03 0.03 0.08 0.06 0.03 0.05 0.06 0.05 0.02 0.04 0.05 0.04 0.03 0.07 0.03 0.03 0.04 0.05 0.05 0.04 0.03 0.07 0.04 0.02 0.05 0.07 0.06 0.02 0.05 0.08 0.03 0.01 0.05 0.10 0.02 0.01 0.04 0.08 0.02 0.01 0.03 0.08 0.03 0.01 0.04 0.08 0.02 0.02 0.04 0.06 0.03 0.00 0.03 0.08 0.04 0.00 0.06 0.05 0.04 0.01 0.05 0.06 0.05 0.01 0.06 0.05 0.02 0.02 0.05 0.05 0.03 0.02 0.05 0.06 0.05 0.01 0.05 0.05 0.05 0.02 0.07 0.04 0.04 0.02 0.05 0.06 0.04 0.02 0.06 0.05 0.02 0.03 0.08
HPM5JEW01CGYCQ 136 1.12 0.00 0.89 0.00 0.00 1.00 0.17 0.62 0.61 1.21 0.34 1.39 0.87 1.10 0.88 0.44 1.22 0.94 0.59 0.91 0.47 1.23 1.05 0.70 0.62 0.87 0.98 0.00 0.48 0.34 1.01 1.07 0.25 0.56 1.07 1.03 0.41 0.56 1.03 1.09 0.14 0.89 0.81 1.20 0.26 0.59 1.10 1.16 0.06 0.88 0.97 0.99 0.34 0.68 1.16 1.01 0.18 1.12 1.00 0.69 0.46 0.81 0.86 0.85 0.29 1.38 0.51 1.05 0.90 1.14 0.44 1.00 0.78 1.10 0.47 1.02 0.67 0.99 0.43 1.02 0.61 0.93 0.33 0.96 0.51 0.98 0.34 0.97 0.47 0.83 0.37 0.94 0.41 0.76 0.52 0.81 0.38 0.70 0.69 0.91 0.23 0.79 0.76 0.85 0.19 0.74 0.81 0.72 0.12 0.82 0.95 0.62 0.06 0.96 0.96 0.88 0.03 1.06 0.83 0.98 0.10 1.13 0.65 1.12 0.15 1.10 0.53 1.12 0.15 0.89 0.42 1.03 0.11 0.70 0.29 0.88 0.12 0.49 0.18 0.75 0.07 0.47 0.10 0.63 0.07 0.37 0.10 0.46 0.06 0.29 0.10 0.37 0.08 0.18 0.08 0.31 0.07 0.19 0.11 0.28 0.14 0.19 0.11 0.28 0.18 0.20 0.13 0.27 0.20 0.28 0.13 0.24 0.22 0.23 0.17 0.21 0.24 0.24 0.16 0.20 0.25 0.29 0.12 0.23 0.20 0.30 0.14 0.21 0.23 0.28 0.12 0.20 0.15 0.34 0.09 0.19 0.12 0.35 0.09 0.18 0.14 0.30 0.10 0.20 0.11 0.24 0.09 0.18 0.09 0.27 0.09 0.18 0.10 0.24 0.10 0.19 0.11 0.20 0.09 0.16 0.11 0.18 0.10 0.18 0.12 0.21 0.09 0.19 0.10 0.18 0.10 0.17 0.10 0.17 0.11 0.17 0.07 0.20 0.10 0.15 0.10 0.16 0.10 0.13 0.05 0.14 0.10 0.13 0.05 0.17 0.12 0.12 0.04 0.18 0.11 0.12 0.03 0.16 0.12 0.09 0.03 0.13 0.12 0.11 0.00 0.11 0.11 0.10 0.00 0.09 0.14 0.12 0.00 0.08 0.12 0.10 0.00 0.08 0.12 0.08 0.00 0.04 0.12 0.10 0.00 0.06 0.11 0.09 0.00 0.08 0.11 0.10 0.00 0.08 0.09 0.11 0.00 0.08 0.06 0.12 0.00 0.04 0.09 0.13 0.00 0.05 0.06 0.17 0.01 0.06 0.03 0.16 0.02 0.06 0.03 0.14 0.02 0.06 0.00 0.13 0.05 0.08 0.00 0.12 0.07 0.06 0.00 0.10 0.07 0.08 0.00 0.10 0.07 0.08 0.00 0.10 0.07 0.06 0.00 0.07 0.10 0.08 0.00 0.09 0.07 0.05 0.00 0.08 0.07 0.04 0.00 0.10 0.06 0.04 0.00 0.11 0.07 0.04 0.00 0.06 0.07 0.04 0.00 0.08 0.07 0.03 0.00 0.10 0.08 0.02 0.00 0.10 0.07 0.02 0.00 0.10 0.08 0.01 0.00 0.10 0.07 0.02 0.00 0.10 0.07 0.01 0.00 0.10 0.08 0.02 0.00 0.08 0.08 0.02 0.00 0.08 0.07 0.01 0.00 0.05 0.06 0.01 0.00 0.04 0.06 0.00 0.02 0.05 0.03 0.01 0.00 0.02 0.02 0.01 0.01 0.01 0.02 0.01 0.03 0.03 0.02 0.01 0.02 0.02 0.03 0.00 0.04 0.01 0.04 0.00 0.03 0.00 0.02 0.00 0.01 0.00 0.04 0.00 0.00 0.02 0.02 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.04 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.01 0.01 0.00 0.00 0.00 0.02 0.00 0.00 0.01 0.00 0.00 0.00 0.03 0.01 0.03 0.00 0.05 0.02 0.00 0.00 0.04 0.01 0.00 0.00 0.02 0.04 0.00 0.00 0.04 0.02 0.00 0.00 0.05 0.01 0.00 0.00 0.05 0.00 0.00 0.00 0.06 0.00 0.00 0.00 0.06 0.01 0.00 0.00 0.06 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
HPM5JEW01DPMV7 97 1.03 0.07 0.99 0.08 0.03 1.04 0.04 0.84 1.78 0.13 0.03 1.39 0.19 0.08 0.87 1.09 0.84 1.61 1.09 0.34 1.02 0.47 1.28 0.10 0.53 0.59 1.03 1.24 0.34 1.21 0.62 0.89 0.28 0.66 1.06 0.54 0.11 1.15 0.30 0.76 0.05 0.29 0.87 0.26 0.04 0.92 0.28 0.66 0.58 0.27 0.30 1.12 0.21 0.25 0.94 0.42 0.20 0.73 0.29 1.11 0.09 0.20 0.98 0.85 0.13 0.18 0.96 0.96 0.06 0.86 0.22 0.18 1.31 0.05 0.94 1.11 0.26 1.86 0.22 0.85 0.16 1.00 0.19 0.36 0.62 1.16 0.92 0.24 0.73 0.37 0.73 0.21 0.16 1.95 0.22 0.14 0.77 0.42 0.23 0.68 0.18 1.56 0.16 0.23 1.30 0.31 0.10 0.73 0.29 0.85 0.82 1.23 0.18 0.32 0.78 0.20 0.81 0.16 0.24 0.69 0.14 0.71 0.25 0.81 0.19 0.93 0.99 0.25 1.00 0.27 0.20 0.78 0.15 0.20 1.66 0.25 0.15 2.94 0.23 1.34 0.15 0.23 0.43 0.38 0.08 0.63 0.86 0.08 0.04 1.03 1.06 0.21 0.07 0.70 0.36 1.99 0.10 0.95 0.23 0.63 0.62 0.65 0.14 0.73 0.19 0.48 0.11 0.91 0.14 0.18 0.13 0.43 0.15 0.39 0.18 0.05 0.15 0.29 0.13 0.33 0.08 0.10 0.11 0.23 0.07 0.22 0.08 0.29 0.11 0.21 0.07 0.19 0.11 0.18 0.05 0.22 0.07 0.12 0.06 0.13 0.06 0.13 0.05 0.13 0.04 0.10 0.05 0.10 0.05 0.11 0.05 0.09 0.05 0.11 0.07 0.09 0.05 0.09 0.07 0.09 0.06 0.10 0.07 0.11 0.06 0.09 0.07 0.10 0.05 0.08 0.06 0.10 0.06 0.08 0.06 0.10 0.05 0.09 0.06 0.11 0.07 0.10 0.08 0.09 0.06 0.11 0.09 0.09 0.05 0.11 0.07 0.09 0.05 0.10 0.07 0.09 0.03 0.11 0.07 0.09 0.04 0.10 0.09 0.09 0.05 0.10 0.09 0.10 0.05 0.10 0.08 0.09 0.04 0.10 0.08 0.09 0.05 0.10 0.09 0.09 0.05 0.09 0.08 0.10 0.04 0.08 0.08 0.10 0.04 0.09 0.08 0.09 0.04 0.09 0.07 0.09 0.04 0.10 0.07 0.09 0.03 0.09 0.07 0.10 0.03 0.09 0.08 0.11 0.04 0.11 0.06 0.11 0.05 0.12 0.06 0.12 0.04 0.12 0.06 0.13 0.05 0.10 0.05 0.13 0.05 0.09 0.06 0.11 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.09 0.06 0.10 0.05 0.09 0.07 0.11 0.06 0.10 0.05 0.11 0.06 0.09 0.05 0.11 0.05 0.11 0.06 0.10 0.06 0.12 0.05 0.11 0.07 0.12 0.05 0.13 0.07 0.10 0.06 0.10 0.07 0.11 0.04 0.11 0.08 0.09 0.04 0.09 0.07 0.10 0.04 0.10 0.09 0.10 0.04 0.09 0.06 0.10 0.04 0.09 0.07 0.12 0.05 0.08 0.06 0.12 0.05 0.09 0.06 0.12 0.05 0.11 0.05 0.10 0.05 0.10 0.05 0.09 0.05 0.10 0.06 0.09 0.05 0.10 0.05 0.09 0.05 0.09 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.11 0.05 0.10 0.04 0.10 0.08 0.11 0.04 0.09 0.09 0.10 0.04 0.09 0.08 0.09 0.04 0.10 0.09 0.09 0.05 0.10 0.08 0.10 0.05 0.10 0.07 0.10 0.05 0.10 0.07 0.09 0.05 0.09 0.07 0.09 0.06 0.09 0.07 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.09 0.06 0.11 0.06 0.09 0.06 0.10 0.06 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.08 0.06 0.10 0.05 0.08 0.05 0.11 0.05 0.09 0.06 0.11 0.05 0.09 0.07 0.08 0.05 0.09 0.07 0.09 0.05 0.10 0.06 0.10 0.04 0.13 0.06 0.11 0.04 0.12 0.06 0.12 0.04 0.11 0.06 0.11 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.05 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.05 0.11 0.04 0.10 0.05 0.10 0.04 0.10 0.05 0.10 0.05 0.10 0.05 0.10 0.05 0.09 0.05 0.11 0.05 0.09 0.04 0.11 0.05 0.09 0.04 0.11 0.05 0.09 0.05 0.10 0.04 0.10 0.04 0.10 0.04 0.11 0.04 0.11 0.05 0.10 0.05 0.12 0.06 0.10 0.05 0.10 0.06 0.11 0.05 0.09 0.07 0.12 0.04 0.10 0.06 0.11 0.04 0.10 0.07 0.11 0.04 0.09 0.08 0.11 0.04 0.09 0.09 0.11 0.04 0.10 0.08 0.09 0.04 0.12 0.07 0.09 0.03 0.11 0.07 0.09 0.04 0.10 0.07 0.09 0.04 0.10 0.06 0.09 0.04 0.10 0.06 0.09 0.04 0.09 0.06 0.08 0.04 0.09 0.06 0.09 0.04 0.10 0.05 0.10 0.04 0.10 0.05 0.09 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.10 0.04 0.10 0.05 0.11 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.10 0.03 0.12 0.06 0.09 0.03 0.12 0.05 0.09 0.05 0.13 0.04 0.10 0.04 0.11 0.06 0.09 0.04 0.11 0.05 0.08 0.05 0.11 0.06 0.08 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.10 0.07 0.08 0.05 0.10 0.07 0.09 0.04 0.10 0.08 0.09 0.05 0.11 0.08 0.09 0.04 0.12 0.06 0.08 0.05 0.11 0.06 0.09 0.05 0.10 0.06 0.08 0.05 0.10 0.06 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.09 0.05 0.09 0.05 0.08 0.06 0.08 0.05 0.09 0.05 0.08 0.05 0.09 0.05 0.08 0.05 0.09 0.05 0.09 0.06 0.08 0.05 0.09 0.05 0.08 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.10 0.05 0.09 0.06 0.09 0.05 0.08 0.06 0.09 0.04 0.10 0.06 0.09 0.04 0.09 0.06 0.09 0.05 0.10 0.06 0.09 0.04 0.10 0.08 0.10
HPM5JEW01DXV8S 140 1.10 0.00 1.00 0.00 0.00 0.95 0.10 0.58 1.00 0.59 1.18 0.40 0.11 1.20 1.25 0.89 0.00 1.18 1.17 0.09 0.03 1.66 1.07 0.00 0.51 0.37 1.02 0.19 0.32 0.52 1.04 1.10 0.23 0.77 1.02 1.02 0.19 0.62 0.84 1.11 0.08 0.84 0.56 1.11 0.02 0.51 0.74 0.88 0.04 0.81 0.45 1.23 0.00 0.80 0.15 1.23 0.30 0.58 0.25 1.13 0.24 0.71 0.51 1.14 0.11 0.98 0.30 1.16 0.16 1.17 0.18 1.14 0.45 0.97 0.25 1.03 0.40 1.01 0.46 1.10 0.25 0.93 0.51 1.03 0.39 0.50 0.40 0.96 0.36 0.72 0.35 1.07 0.19 1.00 0.50 0.83 0.33 0.57 0.47 0.72 0.25 0.61 0.76 0.78 0.17 0.98 0.77 0.87 0.19 0.80 0.75 0.92 0.08 0.71 0.97 0.51 0.06 0.94 1.01 0.46 0.05 1.10 0.76 1.08 0.07 1.03 0.43 1.06 0.15 1.18 0.33 1.05 0.14 0.89 0.22 1.04 0.08 0.52 0.20 0.86 0.09 0.46 0.23 0.56 0.13 0.39 0.20 0.49 0.08 0.36 0.14 0.34 0.06 0.28 0.13 0.35 0.06 0.27 0.14 0.26 0.14 0.19 0.11 0.33 0.13 0.20 0.13 0.24 0.12 0.20 0.11 0.31 0.08 0.24 0.05 0.33 0.06 0.32 0.06 0.32 0.06 0.29 0.05 0.30 0.06 0.16 0.03 0.19 0.09 0.10 0.10 0.15 0.12 0.15 0.07 0.11 0.08 0.18 0.08 0.11 0.05 0.14 0.04 0.10 …

6

It seems like mothur is reading beyond the end of the file. Was the flow file created by mothur? Could you try a few things to help me narrow it down?

Let’s try grabbing the end of the file:

//let’s grab the last 100 flows:
imac:debug SarahsWork$ tail -100 seq.flow > seqEnd.flow

Then open seqEnd.flow and add 800 as the first line.

Now try running trim.flows(flow=seqEnd.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8). If that still fails, could you send the seqEnd.flow file to mothur.bugs@gmail.com?

7

Thank you very much for your reply! Sorry for replying late, I was not able to check this earlier.

For your question "Was the flow file created by mothur? ": Yes, I used sffinfo to generate .fasta, .qual and .flow files for the two halves (I named them seq1 and seq2), and then merged them together and named it “seq”.

I tried to follow your suggestion, but cannot run the very first step you suggested. So I hope to know more details about it: I am confused by the “imac:debug SarahsWork$ tail -100 seq.flow > seqEnd.flow”. Is this syntax to be input into mothur? In addition, I am using windows, I am not sure if there is anything I should change…

Thank you in advance!

8

Sorry, the tail command is not available on Windows. How did you merge the files? merge.files command?

9

Yes, I used merge.files command to merge the seq1.flow & seq2.flow, seq1.fasta & seq2.fasta, seq1.qual & seq2.qual together and generated seq.flow, seq.fasta and seq.qual files.

10

You can’t use merge.files to combine the 2 flow files, because the number of flows in included twice. For example:

800
HPM5JEW02ICN5B 783 0.98 0.01 0.98 0.09 0.00 1.06 0.05 0.82 1.14 0.02 1.18 0.09 0.05 0.98 0.05 …
HPM5JEW02FQKQP 772 1.05 0.02 0.96 0.02 0.00 1.02 0.06 1.07 1.03 1.43 0.90 2.12 0.15 0.32 0.85 …
HPM5JEW02FWYMT 564 0.98 0.00 1.01 0.00 0.00 1.04 0.00 1.58 0.14 0.00 1.09 0.17 0.06 0.89 0.12 …
…
800
HPM5JEW02ICN5B 783 0.98 0.01 0.98 0.09 0.00 1.06 0.05 0.82 1.14 0.02 1.18 0.09 0.05 0.98 0.05 …
HPM5JEW02FQKQP 772 1.05 0.02 0.96 0.02 0.00 1.02 0.06 1.07 1.03 1.43 0.90 2.12 0.15 0.32 0.85 …
HPM5JEW02FWYMT 564 0.98 0.00 1.01 0.00 0.00 1.04 0.00 1.58 0.14 0.00 1.09 0.17 0.06 0.89 0.12 …
…

The trim.flows command reads the second 800 as a flow and does not know how to process it. I would recommend running trim.flows, shhh.flows and trim.seqs on the each set of files separately and then merging. I hope this helps.

-Sarah

11

Hi,
I am using mothur v.1.25.1. I have a few trouble with trim.flow command.

  1. I specified minflows=75, maxflows=default and majority of my data went to scrap file. When I looked at the seqs that went to the scrap, a lot of them has length >100bp but the flow no. are low (<100). Are all these seqs actually not good to use for downstream analysis? below is an example of one accession no. from scrap.flow and the same accession no. that shows sequence and quality from .sff file

H2SYBJJ03HJRH8|lb 20 1.00 0.00 1.02 0.02 0.00 1.05 0.02 1.06 0.01 1.38 2.10 1.10 0.03 0.04 1.00 0.07 0.00 0.76 0.03 0.00 0.68 0.01 0.00 1.07 0.01 2.05 0.08 0.00 1.92 0.10 0.00 1.05 0.03 0.04 1.06 0.04 0.02 0.99 0.07 1.09 0.04 1.75 1.08 0.08 1.15 0.11 1.96 1.04 1.04 0.05 0.05 0.96 0.07 1.88 1.85 0.12 0.00 1.97 0.11 0.01 1.05 0.06 0.04 2.05 0.09 0.00 1.96 0.12 0.98 0.04 0.98 0.04 1.90 0.02 0.06 0.98 0.10 1.60 1.05 1.00

H2SYBJJ03HJRH8 length=309 xy=2978_1646 region=3 run=R_2013_01_13_06_43_57_
ACCGCATGAATTGCAGAACTCCGTGAACCAATGGCCTCTTGAACGTGCATTGCGCTCTTG
GGATATGCCTGAGAGCATGTCTGCTTCAGTGCTTCTACTTTCATTTTCTGCTGCTCTTGT
TATCAGGAGCAGTGTTGCTGCATGCTTCTGCAAGTGGCACTGGCATGCTAAATATCAAGT
TTTGCTTGCTGTTGTGACTGATCAACATCTCATGTCGTTTCAGTTGGCGAAACAAAAGCT
CATGTGTGTTCTTAACACCTCCTAGCATGAAGTCAGACAAGTGAACCCGCTGAACTTAAG
CATATGGAT
H2SYBJJ03HJRH8 length=309 xy=2978_1646 region=3 run=R_2013_01_13_06_43_57_
26 26 26 40 40 40 40 40 40 40 40 40 40 40 40 40 34 34 38 39 40 40 40 40 40 39 39 39 39 40 40 40 40 40 40 40 40 40 40 40 30 26 26 26 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39
39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 30 30 40 40 34 34 34 34 40 40 40 40 40 40 40 40 40 40 40 40 40
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 35 34 30 30 30 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 30 30 40 40 40 39 39 39 39 32
33 34 34 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 30 30 30 39 40 30 30 30 39 39 40 40 39 38 38 39 32 32 32 32 40 40 40
40 40 40 40 39 39 39 39 40 40 40 40 40 40 40 40 30 30 30 30 30 39 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 39 39 39 40 40 40 40 30 30 30 40 40 40 40 40
40 40 40 40 40 40 40 40 30

  1. When I looked at the .trim.flow file from the result of the same command above, I found at least 1 seq that has usable flow no. of 108 but has length of 57bp. Why did this seq pass?

H2SYBJJ03HJHH2 108 1.00 0.00 0.98 0.00 0.00 1.08 0.00 1.10 0.00 1.04 1.89 0.08 0.00 1.81 1.74 0.96 0.07 0.94 0.19 0.07 1.1

H2SYBJJ03HJHH2 length=57 xy=2975_0968 region=3 run=R_2013_01_13_06_43_57_
ACCAACCGATGCAGACTCCGTGACCATGGCTCTTGACGTGCATTGCGCTCTTGGGAG

H2SYBJJ03HJHH2 length=57 xy=2975_0968 region=3 run=R_2013_01_13_06_43_57_
37 37 37 25 25 23 23 34 35 35 35 35 32 32 32 32 36 37 37 37 35 34 36 34 37 37 37 33 33 33 36 37 38 37 39 37 39 39 39 39 39 39 37 37 37 39 38 35 33 32 32 32 28 28 28 19 16

Thank you,
Arif

12

What version of 454 are you using?

13

GS FLX Titanium

14

I suspect your sequences are bad. The machine is telling you that your reads are short (length=57) and the flowgram you sent has a “noisy” base at position 21 (0.68). I would suggest you talk with your sequence provider about what went wrong in this run.

Pat

15

I’ll do that. Thank you so much for your help.

arif