TRIM.FLOWS Scraps All Sequences -

Hello,

I have browsed through other threads with similar symptoms (trim.flows - problem with new sff file ; trim.flows in version 1.32 producing empty flow.files) but none of the solutions provided therein helped (The first thread reports the same problem, but is unsolved). My best guess is that it is related to the oligos file, but I could not find where things are breaking down).

I have tried…
…QIIME and samples were successfully split according to barcodes (and cleaning steps yielded no errors). Further, the cleaned data was comparable to what the sequencing facility provided (my lab tries to do all analysis in-house for better consistency).
…different versions of mothur (1.25, 1.27, 1.32.1) on different operating systems.
…subsetting my data into small files (first 1000 sequences) and re-running the analysis.

This is not the first time I am using Mothur, but it is the first time I’m using such a large dataset (~50 barcodes samples). Any advice or help would greatly be appreciated. All of the particulars I can think of that may be useful are below.


Mothur v. 1.32.1
System: Ubuntu 12.04
Sequencing Platform: 454 GS FLX Titanium

SIMPLE OLIGO
forward AGAGTTTGATCMTGGCTCAG 27f
barcode TGACGTATGT BL025_12C

FASTA

IIKFCBR01CX7HM xy=1092_2520
TGACGTATGTAGAGTTTGATCATGGCTCAGAGCGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGCCGTAGCAATACGGAGCGGCAGACGGGAGAGTAACACGTGGGAACGTACCTTTTGGTTCGGAACAACTGAGGGAAACTTCAGCTAATACCGGATAAGCCTACGGGAAGATTATCGCCAAAGATCGGCCGCGTCTGATTAGCTAGTTGGTGGGTAACGGCCCACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCTCA

QUAL

IIKFCBR01CX7HM xy=1092_2520 length=278
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 36 36 36 38 40 40 37 33 31 31 31 35 40 40 40 36 33 31 32 31 34 28 28 26 16 16 13 13 13 13 15 15 25 25 29 23 24 23 23 23 23 28 29 31 30 22 11 11 11 13 13 13 15 15 21 19 20 31 29 34 32 37 34 29 29 29 29 29 29 34 31 25 23 13 11 11 11 22 22 17 17 15 15 13 13 17 17 26 24 26 26 18 20 15 15 15 20 26 34 31 21 21 18 18 19 20 20 20 25 28 34 34 36 36 36 36 34 34 34 34 34 31 32 20 15 11 11 11 16 19 19 17 11 11 11 11 13 20 20 21 23 23 18 18 19 29 29 36 36 36 30 30 30 29 36 34 31 31 31 34 28 27 23 21 23 25 29 29 27 29 26 27 26 26 30 26 25 18 18 18 34 28 23
sff.txt header
Common Header:
Magic Number: 779314790
Version: 0001
Index Offset: 4030070720
Index Length: 15155206
Number of Reads: 757728
Header Length: 1816
Key Length: 4
Number of Flows: 1779
Format Code: 1
Flow Chars: TACGTACGTACGAT

FLOW
IIKFCBR01CX7HM 507 1.02 0.05 1.00 0.04 0.00 0.99 0.04 1.00 1.02 0.01 0.00 1.01 1.04 0.01 0.00 0.00 0.00 0.00 0.00 1.10 1.02 0.04 0.00 0.00 0.01 1.00 0.02 1.04 0.99 0.04 0.00 1.02 0.00 0.00 0.00 0.00 0.00 0.00 0.99 1.03 0.03 1.08 0.01 0.00 0.00 1.01 0.01 1.03 0.03 2.86 0.07 0.00 0.00 0.00 1.06 0.00 0.00 1.06 0.00 0.00 0.00 0.00 0.00 1.06 0.04 0.00 0.01 0.00 1.10 1.10 0.03 0.93 1.90 0.99 0.03 0.89 0.00 0.96 0.93 0.94 0.04 0.01 0.94 0.00 0.01 1.01 0.00 0.00 0.99 0.98 0.01 0.00 1.80 0.07 1.01 0.04 0.96 0.93 0.99 0.03 1.98 0.95 0.01 0.00 0.00 2.00 0.07 0.91 0.00 0.00 0.00 0.99 0.00 0.00 2.06 0.08 0.00 2.15 0.09 0.02 0.00 1.03 0.04 2.06 1.10 0.06 1.06 0.00 1.05 0.00 0.00 0.95 1.07 0.05 0.00 0.00 1.02 0.00 1.00 1.95 1.12 1.02 0.05 1.02 0.00 0.00 0.94 0.02 1.06 1.06 0.04 0.97 0.98 0.00 0.00 1.89 0.03 0.00 0.01 0.01 0.00 0.00 0.00 0.91 0.03 0.00 0.00 0.01 0.00 0.00 0.99 1.02 0.05 1.04 0.03 0.01 0.99 2.00 1.10 0.00 1.03 0.03 1.03 0.01 0.01 0.00 2.09 0.03 0.04 0.96 1.08 1.01 0.03 2.01 1.08 0.08 1.01 0.04 0.89 0.02 0.00 1.08 0.00 0.01 0.00 1.03 0.00 0.00 3.07 0.09 0.90 0.03 0.01 1.11 1.07 0.02 0.00 0.94 0.06 0.05 0.94 0.08 1.76 1.05 0.04 0.91 0.09 0.97 0.98 0.05 0.14 0.88 0.02 0.00 0.05 3.01 0.06 0.06 1.90 0.06 0.01 0.01 1.03 0.00 1.04 1.04 0.26 1.12 2.08 3.54 2.05 0.15 1.95 0.97 1.84 0.05 0.03 1.68 0.05 1.06 1.89 0.10 0.99 1.10 0.03 1.00 0.01 0.98 0.10 0.08 2.62 2.54 0.98 1.71 0.21 0.96 0.97 0.03 0.96 0.04 0.00 0.00 0.00 0.88 0.05 0.09 0.00 0.01 0.01 1.01 0.06 2.04 1.09 0.07 0.02 0.01 0.85 2.13 2.12 0.06 1.15 0.01 1.02 1.90 0.13 1.04 0.08 0.04 2.47 0.16 1.43 0.70 0.06 0.03 0.00 1.08 3.10 0.13 2.43 0.29 0.81 0.96 0.15 0.32 0.31 2.22 0.11 0.16 0.00 0.97 1.16 0.15 0.09 0.95 1.15 0.06 1.90 3.28 1.08 0.09 0.08 0.00 0.91 1.08 0.00 0.00 0.00 1.01 0.16 0.05 0.12 1.93 0.07 2.38 0.07 0.80 1.19 0.21 1.14 0.26 0.75 0.18 0.13 0.19 0.17 1.03 0.08 0.10 0.86 1.01 0.10 1.08 2.03 0.05 0.06 1.10 1.01 0.10 0.01 0.05 1.09 0.89 0.04 1.05 0.03 0.05 0.99 2.00 0.19 0.12 0.00 0.02 0.04 2.05 0.13 0.88 0.14 3.47 0.12 0.06 0.77 0.02 0.27 1.78 1.01 0.15 1.58 2.75 1.10 0.10 0.13 0.04 0.02 0.00 0.07 1.77 0.23 1.96 1.91 1.36 0.24 0.08 0.19 0.19 0.03 0.02 0.00 1.18 0.98 1.00 0.95 0.02 1.03 0.05 0.89 0.04 1.06 0.32 0.07 0.31 0.11 1.01 0.93 1.13 0.02 0.93 0.13 0.00 0.95 0.22 0.00 1.06 0.18 1.19 0.03 0.09 0.00 0.11 0.07 1.95 0.18 0.98 0.00 0.29 0.66 0.06 0.93 0.22 0.68 0.96 0.10 0.02 1.16 0.00 1.36 0.00 0.06 2.05 1.02 1.30 0.10 1.14 0.13 0.94 1.11 0.10 0.03 1.25 0.06 1.07 0.00 0.13 1.34 1.91 0.00 1.00 0.06 0.01 1.05 0.00 0.13 0.15 0.95 0.07 0.00 0.00 0.84 0.37 0.31 3.28 1.37 0.05 0.87 0.85 0.05 0.00 2.12 0.11 0.05 1.05 0.66 0.22 0.52 0.00 1.04 0.32 0.65 0.00 0.00 0.02 1.02 0.03 2.54 0.09 0.05 2.80 1.40 0.00 0.34 0.24 1.16 0.10 0.10 0.03 0.01 0.00 0.04 1.00 0.48 0.01 0.07 0.61 0.11 1.30 2.21 0.08 1.00 0.01 0.04 0.00 1.20 0.91 3.33 0.11 0.84 2.34 0.14 0.09 1.22 0.00 0.13 0.07 0.06 0.81 0.10 0.05 1.00 0.10 0.02 0.91 0.42 0.00 1.28 0.00 1.60 0.08 0.00 0.00 0.13 0.89 0.27 4.46 0.36 2.04 1.06 1.10 1.95 0.00 1.69 0.25 0.04 0.41 0.77 0.00 0.05 0.49 2.61 0.00 1.58 2.80 0.25 1.09 0.63 1.58 0.05 0.00 0.99 0.31 0.00 0.00 2.63 0.02 0.08 0.06 0.94 2.35 0.99 0.00 1.43 0.21 1.17 0.43 1.93 0.00 0.43 0.21 0.07 0.85 1.22 1.00 1.57 0.00 0.13 0.61 1.22 0.00 0.03 0.00 1.36 0.00 1.45 0.04 0.00 0.09 0.28 0.07 0.04 0.59 0.08 0.01 3.50 1.18 0.14 0.00 0.04 0.06 0.02 0.00 0.66 0.00 0.80 0.30 1.20 1.98 0.00 0.73 0.08 2.00 1.62 0.00 1.18 0.23 0.07 2.78 1.87 0.00 0.00 0.00 0.03 0.01 0.00 1.14 0.11 3.66 1.01 2.08 0.00 3.48 1.03 1.37 0.00 0.07 0.00 1.45 0.26 1.69 0.00 0.05 0.92 0.82 1.21 0.00 0.78 0.04 1.17 1.17 0.19 0.95 0.72 1.40 0.00 0.00 0.22 0.44 0.00 0.93 0.00 0.00 0.00 2.14 0.37 0.00 0.80 0.39 0.88 0.00 0.00 0.00 1.68 0.00 1.30 1.81 0.27 0.00 0.00 0.00 0.05 0.39 0.23 3.77 0.25 0.37 2.40 0.00 0.01 0.02 1.46 2.04 0.00 0.00 0.09 0.31 0.00 0.25 0.45 0.00 1.25 0.00 0.00 1.35 0.71 0.20 0.36 1.19 0.06 0.00 0.06 0.12 0.10 0.01 0.20 0.19 0.08 0.69 0.00 0.00 0.47 0.02 0.27 0.72 0.17 0.00 3.58 0.86 1.42 0.00 1.77 2.24 2.87 0.00 0.44 0.66 0.00 0.45 1.21 0.00 0.07 0.02 0.11 0.00 0.97 0.12 0.27 0.92 0.11 2.34 0.00 1.37 1.22 0.55 0.17 0.85 0.38 0.12 0.21 0.82 0.93 0.23 0.42 0.62 0.40 1.27 1.34 1.32 0.34 0.27 1.29 1.01 0.23 0.51 0.26 0.02 1.27 0.14 0.04 0.66 0.75 0.04 1.17 0.88 2.47 0.65 0.62 0.53 0.16 0.89 1.26 0.26 1.33 0.10 0.46 0.73 0.66 0.18 0.05 0.66 0.31 0.26 0.41 0.32 0.39 0.42 0.17 0.12 0.26 0.60 0.21 0.26 0.23 0.00 0.50 0.83 0.10 0.19 0.70 0.12 0.00 0.16 1.33 0.50 0.02 0.38 0.19 0.41 0.28 0.09 0.33 0.25 0.32 0.17 0.09 1.29 0.13 0.42 0.36 0.18 0.02 0.45 0.56 0.11 0.23 0.08 0.05 0.06 0.03 0.01 0.17 0.03 0.03 0.00 0.03 0.00 0.16 0.03 0.13 0.16 0.03 0.12 0.06 0.05 0.01 0.11 0.10 0.08 0.11 0.28 0.23 0.04 0.29 0.12 0.01 0.25 0.03 0.02 0.09 0.16 0.00 0.21 0.14 0.07 0.16 0.10 0.44 0.08 0.09 0.16 0.07 0.13 0.03 0.08 0.12 0.26 0.08 0.02 0.14 0.08 0.04 0.12 0.12 0.06 0.08 0.01 0.15 0.05 0.00 0.17 0.08 0.05 0.09 0.03 0.32 0.08 0.11 0.14 0.08 0.04 0.07 0.16 0.13 0.06 0.03 0.01 0.00 0.06 0.16 0.01 0.08 0.07 0.07 0.05 0.03 0.05 0.16 0.04 0.15 0.01 0.07 0.02 0.03 0.23 0.07 0.05 0.06 0.08 0.02 0.10 0.02 0.05 0.00 0.02 0.00 0.16 0.08 0.09 0.11 0.03 0.09 0.06 0.05 0.03 0.12 0.10 0.08 0.04 0.12 0.17 0.10 0.03 0.02 0.07 0.17 0.06 0.11 0.07 0.01 0.14 0.08 0.02 0.10 0.08 0.01 0.08 0.05 0.23 0.08 0.05 0.10 0.09 0.06 0.05 0.07 0.02 0.09 0.12 0.05 0.05 0.10 0.13 0.06 0.05 0.01 0.08 0.03 0.00 0.12 0.08 0.03 0.10 0.04 0.09 0.08 0.17 0.08 0.07 0.04 0.05 0.11 0.03 0.10 0.05 0.01 0.00 0.02 0.13 0.01 0.07 0.10 0.09 0.02 0.02 0.09 0.09 0.04 0.12 0.00 0.04 0.01 0.00 0.29 0.08 0.08 0.03 0.13 0.07 0.05 0.03 0.07 0.00 0.02 0.00 0.25 0.07 0.06 0.10 0.02 0.06 0.06 0.09 0.08 0.10 0.12 0.04 0.01 0.05 0.08 0.03 0.06 0.05 0.00 0.16 0.04 0.02 0.03 0.15 0.01 0.09 0.06 0.11 0.11 0.07 0.03 0.05 0.04 0.08 0.01 0.08 0.02 0.11 0.06 0.08 0.02 0.02 0.11 0.10 0.01 0.10 0.07 0.05 0.07 0.08 0.01 0.07 0.08 0.04 0.08 0.11 0.01 0.07 0.14 0.02 0.05 0.10 0.01 0.01 0.02 0.14 0.05 0.01 0.06 0.07 0.06 0.06 0.03 0.04 0.08 0.03 0.06 0.03 0.07 0.08 0.10 0.02 0.10 0.04 0.00 0.11 0.02 0.01 0.06 0.10 0.01 0.07 0.04 0.08 0.10 0.04 0.06 0.02 0.02 0.07 0.01 0.06 0.00 0.05 0.08 0.07 0.01 0.01 0.07 0.05 0.03 0.07 0.05 0.05 0.04 0.02 0.01 0.04 0.14 0.02 0.06 0.08 0.00 0.06 0.08 0.03 0.05 0.04 0.00 0.01 0.02 0.12 0.05 0.02 0.09 0.06 0.07 0.05 0.04 0.02 0.09 0.04 0.08 0.01 0.11 0.06 0.07 0.02 0.05 0.07 0.03 0.01 0.08 0.05 0.03 0.04 0.04 0.03 0.06 0.05 0.07 0.03 0.04 0.04 0.04 0.02 0.04 0.01 0.04 0.00 0.04 0.07 0.00 0.04 0.07 0.04 0.01 0.01 0.05 0.05 0.00 0.07 0.00 0.03 0.01 0.00 0.08 0.06 0.04 0.00 0.04 0.02 0.04 0.01 0.06 0.00 0.02 0.00 0.07 0.03 0.06 0.07 0.01 0.03 0.04 0.05 0.02 0.06 0.06 0.01 0.01 0.03 0.06 0.00 0.02 0.05 0.00 0.07 0.00 0.00 0.03 0.10 0.00 0.07 0.03 0.12 0.05 0.05 0.03 0.03 0.03 0.05 0.01 0.05 0.00 0.03 0.05 0.03 0.01 0.00 0.04 0.05 0.02 0.05 0.03 0.03 0.02 0.08 0.00 0.02 0.00 0.00 0.07 0.01 0.03 0.01 0.04 0.02 0.01 0.01 0.02 0.00 0.01 0.00 0.10 0.02 0.06 0.03 0.00 0.04 0.02 0.03 0.03 0.04 0.05 0.01 0.00 0.01 0.06 0.01 0.01 0.00 0.03 0.08 0.01 0.04 0.04 0.00 0.04 0.03 0.00 0.02 0.05 0.00 0.04 0.02 0.09 0.06 0.01 0.04 0.04 0.02 0.04 0.01 0.03 0.05 0.04 0.02 0.01 0.05 0.03 0.05 0.00 0.02 0.02 0.03 0.00 0.07 0.05 0.04 0.03 0.01 0.03 0.05 0.04 0.03 0.03 0.02 0.02 0.03 0.01 0.04 0.01 0.03 0.00 0.01 0.05 0.00 0.03 0.04 0.03 0.01 0.00 0.03 0.04 0.03 0.01 0.00 0.02 0.05 0.01 0.05 0.03 0.00 0.03 0.04 0.00 0.02 0.03 0.01 0.01 0.04 0.06 0.03 0.02 0.03 0.06 0.03 0.03 0.00 0.01 0.05 0.04 0.01 0.03 0.05 0.04 0.05 0.01 0.01 0.00 0.02 0.00 0.00 0.05 0.01 0.04 0.02 0.05 0.04 0.01 0.01 0.02 0.00 0.01 0.00 0.07 0.04 0.03 0.02 0.00 0.04 0.01 0.02 0.02 0.04 0.05 0.00 0.02 0.01 0.04 0.00 0.02 0.01 0.02 0.00 0.07 0.03 0.03 0.02 0.02 0.02 0.02 0.03 0.02 0.01 0.01 0.02 0.05 0.03 0.03 0.01 0.02 0.00 0.02 0.06 0.00 0.04 0.04 0.03 0.01 0.01 0.02 0.02 0.00 0.03 0.01 0.00 0.05 0.00 0.00 0.02 0.05 0.00 0.03 0.05 0.04 0.05 0.04 0.00 0.01 0.03 0.05 0.00 0.04 0.00 0.04 0.03 0.02 0.00 0.00 0.02 0.06 0.00 0.02 0.05 0.03 0.01 0.02 0.01 0.02 0.03 0.01 0.03 0.03 0.00 0.03 0.02 0.00 0.02 0.03 0.00 0.00 0.01 0.07 0.02 0.01 0.04 0.02 0.03 0.04 0.00 0.03 0.03 0.03 0.02 0.01 0.05 0.03 0.05 0.00 0.01 0.00 0.02 0.03 0.00 0.06 0.01 0.02 0.00 0.01 0.02 0.03 0.02 0.02 0.00 0.01 0.00 0.07 0.01 0.02 0.03 0.01 0.03 0.02 0.02 0.03 0.03 0.02 0.00 0.00 0.02 0.03 0.00 0.02 0.03 0.00 0.05 0.00 0.01 0.03 0.06 0.00 0.04 0.02 0.01 0.03 0.01 0.01 0.01 0.02 0.04 0.00 0.05 0.00 0.02 0.03 0.02 0.00 0.00 0.02 0.04 0.00 0.04 0.06 0.02 0.01 0.02 0.04 0.02 0.00 0.04 0.04 0.01 0.03 0.00 0.04 0.02 0.03 0.00 0.03 0.00 0.01 0.02 0.01 0.02 0.00 0.02 0.00 0.01 0.03 0.00 0.02 0.02 0.00 0.00 0.01 0.01 0.05 0.02 0.00 0.01 0.03 0.06 0.00 0.01 0.04 0.00 0.02 0.05 0.00 0.02 0.04 0.00 0.01 0.02 0.04 0.02 0.00 0.04 0.03 0.04 0.03 0.00 0.00 0.02 0.02 0.02 0.00 0.02 0.02 0.03 0.00 0.00 0.01 0.00 0.02 0.00 0.00 0.04 0.04 0.00 0.02 0.03 0.05 0.03 0.02 0.01 0.01

I ran your example flow with 1.32.1 and mother did not scrap it. Did you have the wrong order set?

mothur > trim.flows(flow=flow.flow, oligos=flow.oligos, pdiffs=2, bdiffs=1, order=B)

I have met the same question and puzzled me a lot. I found the number of flows is 1779, I doubt that is a fact and the trim.flows command couldn’t deal it ?

In fact the order is A, and if run the command with the order set at B, I can get the results, but downstream analysis with this data can not get the reasonable results.

In fact the order is A, and if run the command with the order set at B, I can get the results, but downstream analysis with this data can not get the reasonable results.

Sorry but this isn’t clear. If you use B, do you get data out of trim.flows? If you use A do you get data out of trim.flows? The example from the original poster is B. If you run sffinfo and use sfftxt=T you’ll get the text file. If you look at the first 50 lines (head -n 50 *txt) you’ll see a line with the flow order. Can you post that?

Thank you kindly for your quick reply. Setting the (order = B) in trim.flows resulted in successful processing. I will repost here if I meet any additional problems during analysis. One more question: How is one to know which order to select? The trim.flows manual writes: “The order parameter is used to select the flow order. Options are A, B and I. Default=A, meaning flow order of TACG.” As far as I can see from my .sff.txt header, my flow is in that order. What went wrong here?

The text file is:
Common Header:
Magic Number: 0x2E736666
Version: 0001
Index Offset: 227466168
Index Length: 841782

of Reads: 42053

Header Length: 1816
Key Length: 4

of Flows: 1779

Flowgram Code: 1
Flow Chars: TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG*TAC
Key Sequence: GACT

I got data out of trim.flows when I use B, but I think the order parameter with trim.flows command should be set at A, I got no data out when I use A.
Additional, I run the command sffinfo(sff=myfile.sff, flow=T), according to the SOP, “What you have on the first row is the total number of flow values - 800 for Titanium data. For GS FLX it would be 400.”, but my result is 1799, is any problem might be about my sff file?
I have tried to use “trim.flows(flow=hyj.flow, minflows=0, maxflows=720)”, then I found the *.scrap.flow is empty and *.trim.flow is not empty.But the second column’s value mostly smaller than 100, is this meaning that my sequence is not qualified?
720
IBGNLX202JJOQJ 20 0.01 0.02 0.00 0.74 0.04 1.40 0.82 0.04 0.79 1.02 1.07 0.01 0.03 1.02 0.04 0.01 0.00 0.01 0.01 0.98 0.06 0.03 0.00 0.00 0.02 1.0
IBGNLX202HU4TP 20 0.01 0.03 0.00 0.73 0.04 1.40 0.83 0.03 0.79 1.02 1.06 0.05 0.03 1.02 0.03 0.01 0.01 0.01 0.02 1.01 0.02 0.02 0.00 0.00 0.01 1.0
IBGNLX202GZGFP 20 0.02 0.03 0.01 0.74 0.04 1.40 0.82 0.04 0.79 1.01 1.00 0.04 0.02 1.00 0.05 0.02 0.01 0.02 0.02 0.94 0.04 0.02 0.02 0.01 0.02 1.0
IBGNLX202GJCQZ 12 0.01 0.03 0.00 1.00 0.05 1.02 1.01 0.04 0.98 1.01 0.02 0.99 0.02 0.00 0.00 0.01 0.01 0.00 0.01 0.94 0.03 0.03 0.01 0.00 0.01 1.0
IBGNLX202IEX7S 20 0.02 0.03 0.01 0.74 0.04 0.84 1.37 0.05 0.81 1.01 1.00 0.03 0.03 1.02 0.02 0.02 0.02 0.01 0.02 0.94 0.03 0.03 0.00 0.00 0.02 1.0
IBGNLX202FYORJ 32 0.00 0.01 0.00 1.00 0.02 1.03 0.99 0.03 1.05 1.07 1.04 0.03 0.02 1.00 0.03 0.00 0.00 0.01 0.01 1.01 0.04 1.03 0.03 0.00 0.00 1.0
IBGNLX202G8LQ0 88 0.03 0.03 0.01 1.02 0.05 1.02 0.99 0.04 1.04 0.02 1.06 0.02 0.05 1.09 1.08 0.05 1.07 0.05 0.04 1.06 1.07 1.04 0.05 0.00 0.03 2.0
IBGNLX202FNZ8W 12 0.00 0.01 0.00 1.01 0.00 1.01 1.00 0.02 1.01 1.03 0.02 0.97 0.01 0.00 0.00 0.00 0.00 0.00 0.00 1.02 0.01 0.00 0.00 0.00 0.00 1.0

Thanks,
xiaobo

Indeed, ZhangXiaobo may have a point. I’m pretty sure the order of my flow is A (based on what I quote from trim.flows above), but trim.flows only works when I set the order to B. HOWEVER, now that I’ve pushed all 400K sequences through sssh.flows, the trim.seqs command scraps all of my sequences. Please advise.

Thanks!

Following trim.flows, the commands I used were:

shhh.flows(file=$n, processors=6)
trim.seqs(fasta=$n, oligos=$o, name=$m, pdiffs=2, bdiffs=1, maxhomop=8, minlength=200)

Hello

I think you must pass your sequences in shhh.flows command with the order=B argument

shhh.flows(file=sequence.flow.files, order=B, processors=8)

You are correct Patg13. Thank you for your input. In summary, if trim.flows scraps ALL your sequences, check the flow pattern using the sffinfo() with sfftxt=T. Determine whether it is A, B or I and then run BOTH trim.flows and ssh.flows with the Order = A|B|I .

Thanks,

TACGTACGTACGAT

That is B.

I have followed all of the threads regarding this topic as I am having a similar problem. All of my files get placed in the scrap.flows except 2 samples. When I look they are all scraped based on barcode and primer. If I up the values for pdiff and bdiff I can get the trim flows to keep 24 (out of 48 samples). When I asked the sequence provider to confirm that the barcodes/primer were correct I was informed that “of course the information provided is correct otherwise we could not have given you the preliminary OTU analysis you received”. Any advice? Is there a way I could get the barcode/primers out of the original sff file?

Can you post your sff file somewhere for us to pull down and take a look at? Once you do- email us at mothur.bugs@gmail.com and include the url for this post.

Also, you could run sffinfo(sff=whatever.sff, sfftxt=T). This will convert your sff file to a text file and you should be able to see what your individual reads look like without trimming.

Who did your sequencing?
Pat

I have previously done the sffinfo and I don’t see any reason why most of my reads would be scrapped. The sequencing was done at RTL. https://www.dropbox.com/s/km6anmccsomq72t/avk.sff

Ah, that might actually explain a lot :slight_smile: can you post the barcode sequences?

Yes, I understand that :slight_smile: However, the sequencing was done prior to my involvement.

Here is the oligos file I was given.

#SampleID BarcodeSequence LinkerPrimerSequence BarcodeName Repeats ProjectName Description
L1 ACTGCACA AGRGTTTGATCMTGGCTCAG 27Fmodtit110 032213AVK27F L1
L10 ACTGTCTC AGRGTTTGATCMTGGCTCAG 27Fmodtit119 032213AVK27F L10
L11 ACTGTGAC AGRGTTTGATCMTGGCTCAG 27Fmodtit120 032213AVK27F L11
L12 ACTGTGTG AGRGTTTGATCMTGGCTCAG 27Fmodtit121 032213AVK27F L12
L13 AGACACAG AGRGTTTGATCMTGGCTCAG 27Fmodtit122 032213AVK27F L13
L14 AGACACTC AGRGTTTGATCMTGGCTCAG 27Fmodtit123 032213AVK27F L14
L15 AGACAGAC AGRGTTTGATCMTGGCTCAG 27Fmodtit124 032213AVK27F L15
L16 AGACAGTG AGRGTTTGATCMTGGCTCAG 27Fmodtit125 032213AVK27F L16
L17 AGACCACT AGRGTTTGATCMTGGCTCAG 27Fmodtit126 032213AVK27F L17
L18 AGACCAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit127 032213AVK27F L18
L19 AGACCTCA AGRGTTTGATCMTGGCTCAG 27Fmodtit128 032213AVK27F L19
L2 ACTGCAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit111 032213AVK27F L2
L20 AGACCTGT AGRGTTTGATCMTGGCTCAG 27Fmodtit129 032213AVK27F L20
L21 AGACGACA AGRGTTTGATCMTGGCTCAG 27Fmodtit130 032213AVK27F L21
L22 AGACGAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit131 032213AVK27F L22
L23 AGACGTCT AGRGTTTGATCMTGGCTCAG 27Fmodtit132 032213AVK27F L23
L24 AGACGTGA AGRGTTTGATCMTGGCTCAG 27Fmodtit133 032213AVK27F L24
L25 AGACTCAC AGRGTTTGATCMTGGCTCAG 27Fmodtit134 032213AVK27F L25
L26 AGACTCTG AGRGTTTGATCMTGGCTCAG 27Fmodtit135 032213AVK27F L26
L27 AGACTGAG AGRGTTTGATCMTGGCTCAG 27Fmodtit136 032213AVK27F L27
L28 AGACTGTC AGRGTTTGATCMTGGCTCAG 27Fmodtit137 032213AVK27F L28
L29 AGAGACAC AGRGTTTGATCMTGGCTCAG 27Fmodtit138 032213AVK27F L29
L3 ACTGCTCT AGRGTTTGATCMTGGCTCAG 27Fmodtit112 032213AVK27F L3
L30 AGAGACTG AGRGTTTGATCMTGGCTCAG 27Fmodtit139 032213AVK27F L30
L31 AGAGAGAG AGRGTTTGATCMTGGCTCAG 27Fmodtit140 032213AVK27F L31
L32 AGAGAGTC AGRGTTTGATCMTGGCTCAG 27Fmodtit141 032213AVK27F L32
L33 ACAGGTCG AGRGTTTGATCMTGGCTCAG 27Fmodtit142 032213AVK27F L33
L34 ACAGTATC AGRGTTTGATCMTGGCTCAG 27Fmodtit143 032213AVK27F L34
L35 ACAGTGAA AGRGTTTGATCMTGGCTCAG 27Fmodtit144 032213AVK27F L35
L36 ACATCCAT AGRGTTTGATCMTGGCTCAG 27Fmodtit145 032213AVK27F L36
L37 ACCAACAT AGRGTTTGATCMTGGCTCAG 27Fmodtit146 032213AVK27F L37
L38 ACCACTAT AGRGTTTGATCMTGGCTCAG 27Fmodtit147 032213AVK27F L38
L39 ACCATACG AGRGTTTGATCMTGGCTCAG 27Fmodtit148 032213AVK27F L39
L4 ACTGCTGA AGRGTTTGATCMTGGCTCAG 27Fmodtit113 032213AVK27F L4
L40 ACCGAAAG AGRGTTTGATCMTGGCTCAG 27Fmodtit149 032213AVK27F L40
L41 ACCGACAT AGRGTTTGATCMTGGCTCAG 27Fmodtit150 032213AVK27F L41
L42 ACCGCAGG AGRGTTTGATCMTGGCTCAG 27Fmodtit151 032213AVK27F L42
L43 ACCGCTAC AGRGTTTGATCMTGGCTCAG 27Fmodtit152 032213AVK27F L43
L44 ACCGGCTT AGRGTTTGATCMTGGCTCAG 27Fmodtit153 032213AVK27F L44
L45 ACCGTAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit154 032213AVK27F L45
L46 ACCGTGCC AGRGTTTGATCMTGGCTCAG 27Fmodtit155 032213AVK27F L46
L47 ACCTAATG AGRGTTTGATCMTGGCTCAG 27Fmodtit156 032213AVK27F L47
L48 ACCTGAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit157 032213AVK27F L48
L5 ACTGGACT AGRGTTTGATCMTGGCTCAG 27Fmodtit114 032213AVK27F L5
L6 ACTGGAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit115 032213AVK27F L6
L7 ACTGGTCA AGRGTTTGATCMTGGCTCAG 27Fmodtit116 032213AVK27F L7
L8 ACTGGTGT AGRGTTTGATCMTGGCTCAG 27Fmodtit117 032213AVK27F L8
L9 ACTGTCAG AGRGTTTGATCMTGGCTCAG 27Fmodtit118 032213AVK27F L9


Thank you for your help!!!!

Sorry - and can you post what you’re using as your oligos file?

Ok maybe this is my problem? I was what I had posted as my oligos file :slight_smile: Minus the “repeats” column…

#SampleID BarcodeSequence LinkerPrimerSequence BarcodeName ProjectName Description
L1 ACTGCACA AGRGTTTGATCMTGGCTCAG 27Fmodtit110 032213AVK27F L1
L10 ACTGTCTC AGRGTTTGATCMTGGCTCAG 27Fmodtit119 032213AVK27F L10
L11 ACTGTGAC AGRGTTTGATCMTGGCTCAG 27Fmodtit120 032213AVK27F L11
L12 ACTGTGTG AGRGTTTGATCMTGGCTCAG 27Fmodtit121 032213AVK27F L12
L13 AGACACAG AGRGTTTGATCMTGGCTCAG 27Fmodtit122 032213AVK27F L13
L14 AGACACTC AGRGTTTGATCMTGGCTCAG 27Fmodtit123 032213AVK27F L14
L15 AGACAGAC AGRGTTTGATCMTGGCTCAG 27Fmodtit124 032213AVK27F L15
L16 AGACAGTG AGRGTTTGATCMTGGCTCAG 27Fmodtit125 032213AVK27F L16
L17 AGACCACT AGRGTTTGATCMTGGCTCAG 27Fmodtit126 032213AVK27F L17
L18 AGACCAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit127 032213AVK27F L18
L19 AGACCTCA AGRGTTTGATCMTGGCTCAG 27Fmodtit128 032213AVK27F L19
L2 ACTGCAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit111 032213AVK27F L2
L20 AGACCTGT AGRGTTTGATCMTGGCTCAG 27Fmodtit129 032213AVK27F L20
L21 AGACGACA AGRGTTTGATCMTGGCTCAG 27Fmodtit130 032213AVK27F L21
L22 AGACGAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit131 032213AVK27F L22
L23 AGACGTCT AGRGTTTGATCMTGGCTCAG 27Fmodtit132 032213AVK27F L23
L24 AGACGTGA AGRGTTTGATCMTGGCTCAG 27Fmodtit133 032213AVK27F L24
L25 AGACTCAC AGRGTTTGATCMTGGCTCAG 27Fmodtit134 032213AVK27F L25
L26 AGACTCTG AGRGTTTGATCMTGGCTCAG 27Fmodtit135 032213AVK27F L26
L27 AGACTGAG AGRGTTTGATCMTGGCTCAG 27Fmodtit136 032213AVK27F L27
L28 AGACTGTC AGRGTTTGATCMTGGCTCAG 27Fmodtit137 032213AVK27F L28
L29 AGAGACAC AGRGTTTGATCMTGGCTCAG 27Fmodtit138 032213AVK27F L29
L3 ACTGCTCT AGRGTTTGATCMTGGCTCAG 27Fmodtit112 032213AVK27F L3
L30 AGAGACTG AGRGTTTGATCMTGGCTCAG 27Fmodtit139 032213AVK27F L30
L31 AGAGAGAG AGRGTTTGATCMTGGCTCAG 27Fmodtit140 032213AVK27F L31
L32 AGAGAGTC AGRGTTTGATCMTGGCTCAG 27Fmodtit141 032213AVK27F L32
L33 ACAGGTCG AGRGTTTGATCMTGGCTCAG 27Fmodtit142 032213AVK27F L33
L34 ACAGTATC AGRGTTTGATCMTGGCTCAG 27Fmodtit143 032213AVK27F L34
L35 ACAGTGAA AGRGTTTGATCMTGGCTCAG 27Fmodtit144 032213AVK27F L35
L36 ACATCCAT AGRGTTTGATCMTGGCTCAG 27Fmodtit145 032213AVK27F L36
L37 ACCAACAT AGRGTTTGATCMTGGCTCAG 27Fmodtit146 032213AVK27F L37
L38 ACCACTAT AGRGTTTGATCMTGGCTCAG 27Fmodtit147 032213AVK27F L38
L39 ACCATACG AGRGTTTGATCMTGGCTCAG 27Fmodtit148 032213AVK27F L39
L4 ACTGCTGA AGRGTTTGATCMTGGCTCAG 27Fmodtit113 032213AVK27F L4
L40 ACCGAAAG AGRGTTTGATCMTGGCTCAG 27Fmodtit149 032213AVK27F L40
L41 ACCGACAT AGRGTTTGATCMTGGCTCAG 27Fmodtit150 032213AVK27F L41
L42 ACCGCAGG AGRGTTTGATCMTGGCTCAG 27Fmodtit151 032213AVK27F L42
L43 ACCGCTAC AGRGTTTGATCMTGGCTCAG 27Fmodtit152 032213AVK27F L43
L44 ACCGGCTT AGRGTTTGATCMTGGCTCAG 27Fmodtit153 032213AVK27F L44
L45 ACCGTAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit154 032213AVK27F L45
L46 ACCGTGCC AGRGTTTGATCMTGGCTCAG 27Fmodtit155 032213AVK27F L46
L47 ACCTAATG AGRGTTTGATCMTGGCTCAG 27Fmodtit156 032213AVK27F L47
L48 ACCTGAGT AGRGTTTGATCMTGGCTCAG 27Fmodtit157 032213AVK27F L48
L5 ACTGGACT AGRGTTTGATCMTGGCTCAG 27Fmodtit114 032213AVK27F L5
L6 ACTGGAGA AGRGTTTGATCMTGGCTCAG 27Fmodtit115 032213AVK27F L6
L7 ACTGGTCA AGRGTTTGATCMTGGCTCAG 27Fmodtit116 032213AVK27F L7
L8 ACTGGTGT AGRGTTTGATCMTGGCTCAG 27Fmodtit117 032213AVK27F L8
L9 ACTGTCAG AGRGTTTGATCMTGGCTCAG 27Fmodtit118 032213AVK27F L9

Here’s a link to mothur’s oligos file page, http://www.mothur.org/wiki/Oligos_File.

Excuse my error. That was the old file from Sept. I had already editted it to look like below in Nov and all through Dec I could not get mothur to stop scraping all my samples except 2.

forward AGRGTTTGATCMTGGCTCAG
barcode ACTGCACA L1
barcode ACTGTCTC L10
barcode ACTGTGAC L11
barcode ACTGTGTG L12
barcode AGACACAG L13
barcode AGACACTC L14
barcode AGACAGAC L15
barcode AGACAGTG L16
barcode AGACCACT L17
barcode AGACCAGA L18
barcode AGACCTCA L19
barcode ACTGCAGT L2
barcode AGACCTGT L20
barcode AGACGACA L21
barcode AGACGAGT L22
barcode AGACGTCT L23
barcode AGACGTGA L24
barcode AGACTCAC L25
barcode AGACTCTG L26
barcode AGACTGAG L27
barcode AGACTGTC L28
barcode AGAGACAC L29
barcode ACTGCTCT L3
barcode AGAGACTG L30
barcode AGAGAGAG L31
barcode AGAGAGTC L32
barcode ACAGGTCG L33
barcode ACAGTATC L34
barcode ACAGTGAA L35
barcode ACATCCAT L36
barcode ACCAACAT L37
barcode ACCACTAT L38
barcode ACCATACG L39
barcode ACTGCTGA L4
barcode ACCGAAAG L40
barcode ACCGACAT L41
barcode ACCGCAGG L42
barcode ACCGCTAC L43
barcode ACCGGCTT L44
barcode ACCGTAGA L45
barcode ACCGTGCC L46
barcode ACCTAATG L47
barcode ACCTGAGT L48
barcode ACTGGACT L5
barcode ACTGGAGA L6
barcode ACTGGTCA L7
barcode ACTGGTGT L8
barcode ACTGTCAG L9