Hi there,
Having problem working with Iontorrent data.
sffinfo and trim.flows gets through.
I get the following error message when i run mothur > shhh.flows(flow=A1.trim.flow, processors=8)
Unable to open C:\mothurGUI\mothur\lookupFiles\LookUp_Titanium.pat. Trying mothur's executable location C:\mothurGUI\mothur\LookUp_Titanium.pat
Using 8 processors.
>>>>> Processing A1.trim.flow (file 1 of 1) <<<<<
Reading flowgrams...
Identifying unique flowgrams...
Calculating distances between flowgrams...
0 0 0
0 0 0.004
Total time: 0 0.005
Clustering flowgrams...
[ERROR]: A1.trim.shhh.dist is blank. Please correct.
********************#****#****#****#****#****#****#****#****#****#****#
Reading matrix: ||||||||||||||||||||||||||||||||||||||||||||||||||||
***********************************************************************
Segmentation fault
i tried different commands for trim.flow i.e
mothur > trim.flows(flow=A1.flow, oligos=oligos.txt, pdiffs=1, bdiffs=1, order=I, processors=8)and also
forward AGAGTTTGATCCTGGCTCAG
#reverse CTGCTGCCTYCCGTA
barcode TTCGTGATTC A1
can somebody help me…
thanks
First, you want to use order=I if this is IonTorrent data for both the trim.flows and shhh.flows steps.
Second, can you look at the first line of the flow file and tell me what the number is?
First line of A1.trim.flow is 450
however, its size is just 1KB.
I used order=I for both trim.flows and shhh.flows. No luck…
Sorry - what is the first line of the A1.flow file?
Thanks for the reply… The A1.flow.files is empty. with 0KB data…
Does this mean the read quality are bad?..
You should have a file called A1.flow. What is the number on the first line?
sorry… the first line of the A1.flow, is like this
850
XMCD4:00008:00046 129 0.91 0.09 1.11 0.16 0.00 0.91 0.17 1.01 1.96 2.05 0.00 1.30 1.10 0.10 0.00 0.00 0.83 0.01 0.00 1.86 0.00 0.99 1.24 1.01 0.71 0.18 0.00 0.00 0.67 0.01 0.20 0.00 0.61 0.00 0.00 1.37 0.00 0.00 0.96 0.22 0.50 0.19 0.00 1.50 0.00 0.05 1.88 0.00 1.64 2.00 1.03 0.00 0.87 0.00 0.17 0.87 0.70 0.15 0.00 0.00 2.45 0.07 1.17 0.03 0.89 0.00 0.05 1.07 0.00 0.00 0.97 0.21 0.79 1.03 1.85 0.19 2.85 1.12 0.07 2.17 0.00 0.00 0.90 0.82 0.00 2.78 1.22 1.06 0.00 0.09 0.00 0.07 1.35 0.75 0.14 0.00 2.78 1.85 1.02 0.53 2.57 0.08 0.96 0.15 0.15 0.07 0.00 0.00 1.98 1.01 0.14 0.25 0.95 0.03 0.08 0.91 0.55 0.00 0.21 0.87 0.71 0.15 0.00 0.01 1.35 0.24 3.44 0.15 0.67 2.06 0.81 0.64 0.65 4.25 2.12 0.52 0.00 0.31 0.00 0.68 1.29 1.50 1.32 0.18 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
What region are you sequencing? If you’re in mac/linux, can you run the following from the command line?
cut -f 2 -d " " A1.flow | sort | uniq -c | sort
And then post the results? It looks like it tried generating 850 flows, but for this sequence there were only 129 good flows, which would probably give you about 100 bp. If this is pretty standard for your dataset, then you’ll want to set minflows=120, maxflows=120. But post the results of that command and let me know what you get…
Pat
its a 16srRNA sequence of the microbiome, i amplified V1-V2 regions(approximately 350bp) and sequenced using Iontorrent PGM system.
i ran the commant u gave me through cygwin… and here are the result
SV53AV3WDP001@SSV523K2WDP001 /cygdrive/c/mothurGUI/mothur
$ cut -f 2 -d " " A1_sepsis.flow | sort | uniq -c | sort
1 31
1 33
1 571
1 593
1 617
1 619
1 620
1 622
1 626
1 636
1 642
1 675
1 676
1 708
1 850
2 539
2 585
2 621
2 625
2 661
3 553
3 555
3 558
3 572
3 574
3 590
3 599
3 601
3 607
3 614
3 615
3 624
4 591
4 594
5 554
5 556
5 567
5 576
5 598
5 691
6 34
6 569
6 582
6 584
6 611
6 666
7 475
7 544
7 552
7 560
8 459
8 592
8 596
8 605
8 610
9 583
9 600
10 331
10 540
10 546
10 589
11 508
12 575
13 315
13 443
13 515
13 551
13 634
14 427
15 566
15 659
16 347
16 411
16 542
17 283
17 564
18 537
18 543
18 573
20 550
20 602
21 123
21 645
23 155
23 524
23 568
23 641
24 419
24 512
24 559
25 561
26 267
26 578
28 235
28 557
29 414
29 458
29 478
29 521
29 522
29 579
30 464
31 400
31 466
31 629
33 36
34 91
35 505
37 299
38 448
39 402
39 520
44 363
44 570
45 304
45 336
45 460
46 288
46 487
46 59
50 541
52 562
53 354
55 203
58 518
59 266
60 330
65 320
67 171
67 462
70 396
70 644
71 286
71 577
72 187
74 547
75 413
77 510
78 107
78 382
78 476
81 272
88 376
96 480
99 379
102 244
102 358
103 502
104 318
106 597
107 256
107 451
108 489
109 236
109 370
110 438
112 46
112 523
116 345
119 534
121 229
121 312
121 430
123 366
124 43
125 293
125 386
125 398
125 536
130 416
131 361
132 240
132 280
132 535
134 258
134 426
136 327
141 291
142 303
145 503
146 362
150 261
152 322
153 406
154 302
154 455
154 519
155 491
156 612
157 160
157 198
158 463
160 294
161 444
161 580
162 268
162 364
164 340
167 496
168 332
168 360
170 277
170 38
174 48
176 434
177 613
179 210
180 609
182 263
184 436
184 479
185 441
185 504
187 222
188 390
188 407
190 483
192 355
195 39
199 490
201 309
204 216
204 274
204 64
205 335
206 473
211 311
213 374
215 526
216 338
222 387
222 424
222 528
224 219
224 329
229 384
229 422
230 415
230 482
232 144
232 373
232 446
234 317
245 122
245 270
248 409
249 170
251 488
252 254
253 106
263 289
263 500
264 154
266 186
266 440
269 368
271 432
272 132
274 297
274 450
278 234
279 226
283 282
286 42
288 284
291 245
296 418
297 545
298 137
298 62
304 423
315 172
317 224
324 249
325 511
328 175
335 181
335 454
335 514
337 233
338 196
340 212
342 220
342 506
343 260
345 341
345 492
347 497
348 152
349 351
349 469
349 517
350 230
353 242
356 140
358 232
358 486
366 278
367 265
368 425
370 208
372 445
375 429
376 209
380 158
380 307
381 147
385 174
387 163
387 509
389 60
392 456
397 225
409 474
410 472
413 494
416 372
417 139
418 290
418 375
423 124
424 433
425 104
429 477
431 324
432 238
434 627
438 357
438 392
440 271
441 82
448 395
454 262
454 316
455 239
455 369
461 184
462 176
463 247
468 269
471 313
472 471
473 190
473 499
474 393
476 439
480 214
481 281
484 326
493 495
494 394
502 162
503 352
505 306
509 295
511 350
511 525
513 333
513 334
514 465
515 255
517 257
519 323
520 231
521 108
523 421
527 383
529 228
532 563
534 391
534 468
544 337
548 321
554 428
555 447
556 308
556 417
558 493
560 213
565 420
565 457
565 498
574 410
575 192
576 377
578 529
580 348
581 431
583 218
584 178
585 367
586 365
602 314
630 159
630 204
634 54
638 298
639 195
641 305
642 168
645 408
646 287
648 403
649 353
658 223
659 342
666 452
687 264
690 205
691 359
692 279
692 41
700 388
705 146
710 481
712 115
717 241
727 339
731 346
732 193
734 378
740 344
753 237
755 166
759 300
770 328
775 285
777 301
780 527
781 156
801 227
813 310
816 118
820 217
825 343
825 401
828 385
833 69
834 165
835 319
837 206
838 188
840 58
846 467
847 119
856 96
878 37
882 131
887 221
891 259
892 399
894 273
903 191
909 397
915 201
918 189
919 253
919 532
924 435
926 179
929 381
934 110
939 252
944 126
946 453
956 276
963 325
967 389
971 76
972 292
985 120
986 296
997 405
1002 142
1008 129
1030 202
1032 470
1037 461
1052 180
1053 200
1053 516
1055 136
1055 548
1062 211
1064 371
1065 66
1069 116
1069 150
1077 194
1111 177
1116 215
1119 95
1133 151
1151 44
1156 90
1164 85
1166 243
1173 182
1179 92
1182 135
1186 121
1191 275
1252 207
1255 102
1265 94
1266 183
1270 164
1274 442
1303 199
1309 197
1322 356
1336 133
1350 157
1377 380
1436 349
1441 169
1445 143
1447 111
1456 128
1459 52
1481 449
1535 185
1566 141
1566 40
1567 78
1575 114
1589 145
1592 81
1628 412
1652 113
1665 117
1689 173
1690 167
1690 99
1708 89
1826 138
1836 595
1859 84
1864 103
1891 149
1895 71
1920 581
1977 148
1982 130
1993 105
2049 530
2125 513
2196 485
2234 98
2325 112
2346 63
2377 565
2427 134
2452 404
2579 153
2619 93
2626 100
2645 73
2672 109
2720 67
2742 161
2762 87
2821 127
2961 125
2991 68
3041 251
3161 538
3166 45
3237 101
3279 549
3303 88
3594 57
3876 80
3890 72
3930 246
3971 70
4361 75
4390 79
4475 97
4655 86
4922 77
4936 83
5439 248
5461 484
5797 250
6029 47
6063 56
6223 437
6345 55
6415 51
6876 65
6885 74
10233 53
10770 61
11605 49
15357 50
18120 501
76042 531
98754 533
could you please tell me how would i set the miniflow and maxiflow values.
thanks a lot for the help
After you run trim.flows with flow=I and whatever else you are doing (post the full command, please), can you run the following…
cut -f 2 -d “|” A1.scrap.flow | cut -f 1 -d " " | sort | uniq -c
… and post the output?
It looks like the length is okay, so I suspect there’s a barcode or primer issues
Pat
Thanks for the reply,
I used the following commands until trim flow
mothur > sffinfo(sff=A1_sepsis.sff)
Extracting info from A1_sepsis.sff ...
10000
20000
30000
40000
50000
60000
70000
80000
90000
100000
110000
120000
130000
140000
150000
160000
170000
180000
190000
200000
210000
220000
230000
240000
250000
260000
270000
280000
290000
300000
310000
320000
330000
340000
350000
360000
370000
380000
390000
400000
410000
420000
430000
440000
450000
460000
470000
480000
490000
500000
510000
520000
530000
540000
550000
560000
570000
580000
590000
600000
610000
620000
630000
640000
650000
660000
664995
It took 2057 secs to extract 664995.
Output File Names:
A1_sepsis.fasta
A1_sepsis.qual
A1_sepsis.flow
mothur > trim.flows(flow=A1_sepsis.flow, oligos=oligos.txt, pdiffs=1, bdiffs=1, order=I, processors=8)
Using 8 processors.
10000
20000
30000
40000
50000
60000
70000
80000
90000
100000
110000
120000
130000
140000
150000
160000
170000
180000
190000
200000
210000
220000
230000
240000
250000
260000
270000
280000
290000
300000
310000
320000
330000
340000
350000
360000
370000
380000
390000
400000
410000
420000
430000
440000
450000
460000
470000
480000
490000
500000
510000
520000
530000
540000
550000
560000
570000
580000
590000
600000
610000
620000
630000
640000
650000
660000
664995
Output File Names:
A1_sepsis.trim.flow
A1_sepsis.scrap.flow
A1_sepsis.flow.files
[WARNING]: your sequence names contained ':'. I changed them to '_' to avoid problems in your downstream analysis.
mothur > shhh.flows(file=A1_sepsis.flow.files, order=I, processors=8)
[b][ERROR]: A1_sepsis.flow.files is blank, aborting.[/b]
values for either flow or file must be provided for the shhh.flows command.
Unable to open C:\mothurGUI\mothur\lookupFiles\LookUp_Titanium.pat. Trying mothur's executable location C:\mothurGUI\mothur\LookUp_Titanium.pat
Using 8 processors.
[ERROR]: did not complete shhh.flows.
And with the $ cut -f 2 -d “|” A1_sepsis.scrap.flow | cut -f 1 -d " " | sort | uniq -c i got the follwing result
SV53AV3WDP001@SSV523K2WDP001 /cygdrive/c/mothurGUI/mothur
$ cut -f 2 -d "|" A1_sepsis.scrap.flow | cut -f 1 -d " " | sort | uniq -c
1 850
245168 bf
2 hbf
419771 lbf
54 lhbf
Things are getting tossed because of the barcodes and primers in your oligos files are likely incorrect. Can you run:
trim.seqs(fasta=A1_sepsis.fasta, oligos=oligos.txt)
Does anything go to the trim.fasta file? I suspect no…
If you can compress and post the flow and oligos files to dropbox or google drive I can take a look. Also, please include the url for this post so I can remember what the issue is.
pat
i had amplified the V1-V2 region using the same Forward and Reverse primer given in oligos file.
And you are right. when i ran trim.seqs(fasta=A1_sepsis.fasta, oligos=oligos.txt), none went to trim.fasta file… everything is in scrap.fasta.
this is my oligo file
forward AGAGTTTGATCCTGGCTCAG
#reverse CTGCTGCCTYCCGTA
barcode TTCGTGATTC A1
i will compress the flow file and oligo file and mail you…
thanks a lot
Rosh
I think you’ve got the wrong barcode sequence. When I picked a sequence from your flow file (XMCD4:00058:01166) and translated the first 30 bases I can find your forward primer, but not the barcode sequence. What I see is TTCCGATAACGT, not close to your TTCGTGATTC - the lengths are even different. Can you double check that you’ve got the correct barcode sequences?
Pat
Thanks a lot for the help… i will check the barcode and try to redo the process again. hope i can get it smoothly…
pschloss:
I think you’ve got the wrong barcode sequence. When I picked a sequence from your flow file (XMCD4:00058:01166) and translated the first 30 bases I can find your forward primer, but not the barcode sequence. What I see is TTCCGATAACGT, not close to your TTCGTGATTC - the lengths are even different. Can you double check that you’ve got the correct barcode sequences?
Pat
Thanks a lot for the valuable suggestion. i could see that the Barcode sequence was wrong. I used the right barcode sequence and was able to pass through trim.flow. However, A1.scrap.flow had 2,410,256KB… A1.trim.flow had 195.107KB. i guess most of the reads were filtered into scrap.flow.
I tried proceeding with the shhh.flow… i got this error this msg :[ERROR]: std::bad_alloc has occurred in the ShhherCommand class function driver.
mothur > shhh.flows(file=A1_sepsis.flow.files, order=I, processors=1)
Unable to open C:\mothur\lookupFiles\LookUp_Titanium.pat. Trying mothur's executable location C:\mothur\LookUp_Titanium.pat
Using 1 processors.
>>>>> Processing A1_sepsis.A1.flow (file 1 of 1) <<<<<
Reading flowgrams...
Identifying unique flowgrams...
Calculating distances between flowgrams...
0 0 0
100 0 0.009
200 0 0.033
300 0 0.072
400 0 0.128
500 0 0.201
600 0 0.289
700 1 0.396
800 1 0.529
900 1 0.672
1000 1 0.844
1100 1 1.035
1200 1 1.242
1300 2 1.461
1400 2 1.687
1500 2 1.934
1600 2 2.212
1700 3 2.519
1800 3 2.815
1900 3 3.129
2000 4 3.488
2100 4 3.855
2200 4 4.228
2300 5 4.617
2400 5 5.025
2500 6 5.457
2600 6 5.905
2700 7 6.373
2800 7 6.857
2900 8 7.354
3000 8 7.892
3100 9 8.442
3200 9 9.015
3300 10 9.599
3400 10 10.187
3500 11 10.803
3600 12 11.44
3700 12 12.097
3800 13 12.781
3900 14 13.47
4000 14 14.169
4100 15 14.878
4200 16 15.607
4300 17 16.355
4400 17 17.118
4500 18 17.903
4600 19 18.704
4700 20 19.519
4800 21 20.351
4900 21 21.203
5000 22 22.072
5100 23 22.959
5200 24 23.862
5300 25 24.788
5400 26 25.724
5500 27 26.68
5600 28 27.645
5700 29 28.624
5800 30 29.622
5900 31 30.641
6000 32 31.676
6100 33 32.731
6200 34 33.804
6300 35 34.886
6400 36 35.985
6500 37 37.106
6600 38 38.243
6700 40 39.402
6800 41 40.578
6900 42 41.773
7000 43 42.982
7100 44 44.227
7200 46 45.475
7300 47 46.741
7400 48 48.041
7500 49 49.337
7600 51 50.65
7700 52 51.982
7800 53 53.333
7900 55 54.695
8000 56 56.092
8100 58 57.537
8200 59 58.961
8300 61 60.41
8400 62 61.889
8500 64 63.392
8600 65 64.896
8700 67 66.419
8800 68 67.967
8900 70 69.542
9000 71 71.138
9100 73 72.778
9200 75 74.385
9300 76 76.032
9400 78 77.682
9500 80 79.348
9600 81 81.026
9700 83 82.733
9800 85 84.47
9900 86 86.23
10000 88 88.037
10100 90 89.816
10200 92 91.597
10300 94 93.461
10400 95 95.29
10500 97 97.109
10600 99 98.95
10700 101 100.87
10800 103 102.847
10900 105 104.801
11000 107 106.764
11100 109 108.753
11200 111 110.738
11300 113 112.686
11400 115 114.653
11500 117 116.712
11600 119 118.745
11700 121 120.767
11800 123 122.845
11900 125 124.92
12000 127 127.029
12100 129 129.152
12200 131 131.281
12300 134 133.415
12400 136 135.568
12500 138 137.755
12600 140 139.944
12700 142 142.143
12800 145 144.386
12900 147 146.644
13000 149 148.912
13100 151 151.207
13200 154 153.513
13300 156 155.853
13400 158 158.213
13500 161 160.594
13600 163 162.988
13700 166 165.369
13800 168 167.79
13900 170 170.215
14000 173 172.693
14100 175 175.176
14200 178 177.716
14300 180 180.229
14400 183 182.796
14500 186 185.365
14600 188 187.967
14700 191 190.551
14800 193 193.185
14900 196 195.814
15000 199 198.443
15100 201 201.084
15200 204 203.752
15300 207 206.435
15400 209 209.141
15500 212 211.862
15600 215 214.598
15700 218 217.373
15800 220 220.147
15900 223 222.943
16000 226 225.747
16100 229 228.57
16200 232 231.419
16300 234 234.284
16400 237 237.156
16500 240 240.043
16600 243 242.978
16700 246 245.964
16800 249 248.976
16900 252 251.968
17000 255 254.949
17100 258 257.938
17200 261 260.951
17300 264 263.979
17400 267 267.015
17500 270 270.066
17600 273 273.143
17700 276 276.246
17800 280 279.361
17900 283 282.508
18000 286 285.667
18100 289 288.856
18200 292 292.048
18300 295 295.273
18400 299 298.51
18500 302 301.752
18600 305 305.014
18700 308 308.304
18800 312 311.61
18900 315 314.915
19000 318 318.239
19100 322 321.58
19200 325 324.94
19300 329 328.345
19400 332 331.736
19500 335 335.156
19600 339 338.586
19700 342 342.031
19800 346 345.488
19900 349 348.961
20000 353 352.444
20100 356 355.947
20200 360 359.462
20300 363 363.027
20400 367 366.595
20500 370 370.178
20600 374 373.777
20700 378 377.409
20800 381 381.055
20900 385 384.702
21000 389 388.368
21100 392 392.066
21200 396 395.778
21300 400 399.505
21400 403 403.243
21500 407 407.011
21600 411 410.807
21700 415 414.616
21800 419 418.432
21900 422 422.274
22000 426 426.128
22100 430 429.994
22200 434 433.871
22300 438 437.77
22400 442 441.696
22500 446 445.658
22600 450 449.649
22700 454 453.646
22800 458 457.671
22900 462 461.704
23000 466 465.724
23100 470 469.778
23200 474 473.845
23300 478 478.006
23400 482 482.146
23500 486 486.284
23600 491 490.473
23700 495 494.676
23800 499 498.963
23900 503 503.166
24000 508 507.401
24100 512 511.635
24200 516 515.904
24300 520 520.171
24400 525 524.463
24500 529 528.749
24600 533 533.07
24700 538 537.443
24800 542 541.814
24900 546 546.188
25000 551 550.567
25100 555 554.97
25200 560 559.391
25300 564 563.846
25400 568 568.29
25500 573 572.784
25600 577 577.266
25700 582 581.767
25800 586 586.295
25900 591 590.836
26000 596 595.446
26100 600 600.007
26200 605 604.599
26300 609 609.207
26400 614 613.874
26500 619 618.539
26600 623 623.25
26700 628 627.947
26800 633 632.644
26900 638 637.347
27000 642 642.075
27100 647 646.857
27200 652 651.633
27300 657 656.404
27400 661 661.241
27500 666 666.106
27600 671 670.995
27700 676 675.855
27800 681 680.77
27900 686 685.665
28000 691 690.587
28100 696 695.537
28200 701 700.515
28300 706 705.497
28400 711 710.51
28500 716 715.533
28600 721 720.558
28700 726 725.668
28800 731 730.755
28900 736 735.842
29000 741 740.984
29100 746 746.162
29200 751 751.264
29300 757 756.471
29400 762 761.632
29500 767 766.861
29600 772 772.116
29700 777 777.321
29800 783 782.523
29900 788 787.744
30000 793 792.99
30100 798 798.318
30200 804 803.675
30300 809 809.018
30400 815 814.398
30500 820 819.777
30600 825 825.192
30700 831 830.593
30800 836 836.031
30900 842 841.444
31000 847 846.906
31100 853 852.37
31200 858 857.88
31300 864 863.394
31400 869 868.966
31500 875 874.614
31600 880 880.262
31700 886 885.917
31800 892 891.54
31900 897 897.179
32000 903 902.862
32100 909 908.618
32200 914 914.34
32300 920 920.049
32400 926 925.811
32500 932 931.558
32600 938 937.344
32700 943 943.155
32800 949 948.953
32900 955 954.771
33000 961 960.594
33100 967 966.408
33200 972 972.23
33300 978 978.089
33400 984 983.967
33500 990 989.867
33600 996 995.758
33700 1002 1001.67
33800 1008 1007.61
33900 1014 1013.55
34000 1020 1019.51
34100 1026 1025.5
34200 1032 1031.54
34300 1038 1037.61
34400 1044 1043.66
34500 1050 1049.74
34600 1056 1055.88
34700 1062 1061.99
34800 1068 1068.13
34900 1074 1074.27
35000 1081 1080.39
35100 1087 1086.58
35200 1093 1092.8
35300 1099 1099.08
35400 1105 1105.29
35500 1112 1111.51
35600 1118 1117.75
35700 1124 1124.04
35800 1130 1130.34
35900 1137 1136.62
36000 1143 1142.96
36100 1149 1149.27
36200 1156 1155.62
36300 1162 1162
36400 1169 1168.52
36500 1175 1174.92
36600 1182 1181.35
36700 1188 1187.83
36800 1194 1194.33
36900 1201 1200.88
37000 1208 1207.42
37100 1214 1213.95
37200 1221 1220.56
37300 1227 1227.15
37400 1234 1233.73
37500 1241 1240.35
37600 1247 1246.98
37700 1254 1253.57
37800 1260 1260.21
37900 1267 1266.99
38000 1274 1273.64
38100 1281 1280.36
38200 1287 1287.08
38300 1294 1293.82
38400 1301 1300.57
38500 1308 1307.35
38600 1314 1314.18
38700 1321 1320.99
38800 1328 1327.8
38900 1335 1334.67
39000 1342 1341.53
39100 1349 1348.39
39200 1356 1355.36
39300 1362 1362.34
39400 1369 1369.27
39500 1376 1376.28
39600 1383 1383.32
39700 1391 1390.38
39800 1398 1397.54
39900 1405 1404.55
40000 1412 1411.71
40100 1419 1418.8
40200 1426 1425.92
40300 1433 1433.06
40400 1440 1440.27
40500 1448 1447.51
40600 1455 1454.69
40700 1462 1461.88
40800 1469 1469.12
40900 1476 1476.33
41000 1484 1483.59
41100 1491 1490.98
41200 1499 1498.51
41300 1506 1505.8
41400 1513 1513.08
41500 1521 1520.42
41600 1528 1527.78
41700 1535 1535.08
41800 1543 1542.43
41900 1550 1549.86
42000 1557 1557.25
42100 1565 1564.67
42200 1572 1572.19
42300 1580 1579.73
42400 1587 1587.25
42500 1595 1594.79
42600 1602 1602.31
42700 1610 1609.83
42800 1618 1617.35
42900 1625 1624.91
43000 1633 1632.58
43100 1640 1640.22
43200 1648 1647.81
43300 1656 1655.45
43400 1663 1663.17
43500 1671 1670.93
43600 1679 1678.62
43700 1686 1686.31
43800 1694 1694
43900 1702 1701.73
44000 1710 1709.48
44100 1717 1717.21
44200 1725 1725.01
44300 1733 1732.84
44400 1741 1740.69
44500 1749 1748.58
44600 1757 1756.46
44700 1765 1764.4
44800 1773 1772.35
44900 1780 1780.25
45000 1788 1788.22
45100 1796 1796.19
45200 1804 1804.15
45300 1812 1812.22
45400 1820 1820.26
45500 1828 1828.21
45600 1836 1836.19
45700 1844 1844.27
45800 1853 1852.36
45900 1861 1860.41
46000 1869 1868.47
46100 1877 1876.6
46200 1885 1884.7
46300 1893 1892.8
46400 1901 1900.95
46500 1909 1909.12
46600 1917 1917.31
46700 1926 1925.51
46800 1934 1933.71
46900 1942 1941.91
47000 1950 1950.16
47100 1959 1958.41
47200 1967 1966.69
47300 1975 1974.97
47400 1983 1983.28
47500 1992 1991.62
47600 2000 1999.94
47700 2008 2008.28
47800 2017 2016.66
47900 2025 2025.05
48000 2034 2033.48
48100 2042 2041.9
48200 2051 2050.36
48300 2059 2058.82
48400 2067 2067.28
48500 2076 2075.79
48600 2084 2084.3
48700 2093 2092.84
48800 2102 2101.4
48900 2110 2109.98
49000 2119 2118.57
49100 2127 2127.18
49200 2136 2135.81
49272 2142 2142.03
Total time: 2142 2362.4
Clustering flowgrams...
********************#****#****#****#****#****#****#****#****#****#****#
Reading matrix: |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
***********************************************************************
[ERROR]: std::bad_alloc has occurred in the ShhherCommand class function driver. This error indicates your computer is running out of memory. This is most commonly caused by trying to process a dataset too large, using multiple processors, or a file format issue. If you are running our 32bit version, your memory usage is limited to 4G. If you have more than 4G of RAM and are running a 64bit OS, using our 64bit version may resolve your issue. If you are using multiple processors, try running the command with processors=1, the more processors you use the more memory is required. Also, you may be able to reduce the size of your dataset by using the commands outlined in the Schloss SOP, http://www.mothur.org/wiki/Schloss_SOP. If you are uable to resolve the issue, please contact Pat Schloss at mothur.bugs@gmail.com, and be sure to include the mothur.logFile with your inquiry.
My computer is Octa-core i7 with 16GB RAM. it tried running it with processors=1, it gives the same error.
summary.seqs(fasta=A1_sepsis.fasta)
Start End NBases AmbigsPolymer NumSeqs
Minimum: 1 21 21 0 2 1
2.5%-tile: 1 23 23 0 2 16625
25%-tile: 1 49 49 0 3 166249
Median: 1 156 156 0 4 332498
75%-tile: 1 323 323 0 5 498747
97.5%-tile: 1 330 330 0 6 648371
Maximum: 1 484 484 0 22 664995
Mean: 1 179.788 179.788 0 4.00301
# of Seqs: 664995
Any solutions?..
thanks…
That error is due to your distance matrix being so large that it crushes the RAM supply. You could use a computer with more RAM, use MiSeq, or use a quality score-based method. Your distance matrix is so large because you have so many unique sequences due to the high IonTorrent error rates.
Sorry, IonTorrent is a really bad platform for 16S.
Pat
Hi,
We did the sequencing again with 8 metagenomic samples(multiplexing) in 314 chip using PGM-ion torrent machine. However, when the sequencing completes it gives the individual samples seperated by barcodes.
sorry for the trouble again. we really wanna perform the analysis using MOthur as we cant depend upon online pipeline because of time.
Sincerely
rosh
The main problem is that IonTorrent really should not be used to sequence 16S rRNA genes. The error rate is huge and just causes tons of problems. You are not the first person to experience this problem. It’s a shame that when you resequecned the samples that you weren’t able to do it on the MiSeq.
Your specific problem is likely still due to some problem with the barcodes that you are using for your analysis not being the same as what you used to do the sequencing…
Pat