Using 30 processors.
Reading fastq data...
[ERROR]: no good reads.
Done.
Do you guys know what happens? Thank you.
Just an update for my previous posts. Probably I should first using make.contigs() to combine my data first. But I do not have an index file like Undetermined_S0_L001_I1_001.fastq, I only have Undetermined_S0_L001_R1_001.fastq, Undetermined_S0_L001_R2_001.fastq, POOL_S1_L001_R1_001.fastq and POOL_S1_L001_R2_001.fastq. Can somebody tell me how to generate an index file with my barcode information? Will greatly appreciate it . Thank you.
I am pretty new with mothur. I downloaded my recent data from illumina, and it returns me four files. Two of them are pretty big in gigabits, with the name of Undetermined_S0_L001_R1_001.fastq and Undetermined_S0_L001_R2_001.fastq, two of them are pretty small with the name of POOL_S1_L001_R1_001.fastq and POOL_S1_L001_R2_001.fastq which is like:
@M01942:8:000000000-A8YEK:1:2101:9926:13516 1:N:0:1
CAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTTCTCTAAAAACCATTTTTCGTCCCCTTCGGGGCGGTGGTCTATAGTGTTATTAATATCAAGTTGGGGGAGCACATTGTAGCATTGTGCCAATTCATCCATTAACTTCTC
+
BBAABFFA?FBFGGGGGGGEGGGHHGGGGGGHGGGHGHHHGGGHGHHHHHHHGGHHHHHHHGHGGGHHHHHGGGGGGEGGGHHHFGHHHGHHHHBHHHHHHEHHHHHGGGGGGEHFHHHHFHFDHHGHGHHGHHHFGHHHFHGD0GHHHHC
@M01942:8:000000000-A8YEK:1:2108:18872:18578 1:N:0:1
AGAAGTCGTCATTTGGCGAGAAAGCTCAGTCTCAGGAGGAAGCGGAGCAGTCCAAATGTTTTTGAGATGGCAGCAACGGAAACCATAACGAGCATCATCTTGATTAAGCTCATTAGGGTTAGCCTCGGTACGGTCAGGCATCCACGGCGCT
+
3>AABFFABCCFGGGGGGGGFGHHHHHHHHHHHGHHHGGGHHHGGGGGHHHHHHHHHHGHHHGGGGHHHHHHGGGHGGGGGGHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGHGGGHGGGHHHHHHHHGGGGGG
Now how can I demultiplex those two files? Some suggests trim.seqs and others suggest make.contigs. I can not figure it out. I tried fastq.info and then trim.seqs on the fasta file. My input is
mothur > trim.seqs(fasta=Undetermined_S0_L001_R1_001.fasta, oligos=barcode.oligos, allfiles=T, processors=8)
but get a trim.fasta with 0 kb. So what’s the problem here. My barcoded primer sets are using Caporaso’s protocol and having 5’ Illumina adapter, Forward primer pad, Forward primer linker and Forward primer as forward primer sequence and reverse complement of 3’ Illumina adaptor, Golay barcode, reverse primer pad, linker and reverse primer as reverse sequence. How should I write the oligos file?
Hi and welcome to mothur, :). I would be happy to help. It sounds like you received forward and reverse fastq files as well as forward and reverse index files. The index files are the smaller ones. The index files look like this:
They contain the barcodes for the reads. Is this what you have? If so, you will want to run the make.contigs command, http://www.mothur.org/wiki/Make.contigs, with an oligos file. You need to create an oligos file. Here’s a link to mothur’s oligos file, http://www.mothur.org/wiki/Oligos_File. The command will look like:
Thank you so much for your reply. Unfortunately I do not have an index file like you mentioned. I only have a file with the name of POOL_S1_L001_R2_001.fastq
and all the information in the file is
The make.contigs command does not require the index files. Are the barcodes and primers still on your reads? If so, you can run make.contigs with an oligos file and mothur will remove them for you and assemble the reads.
That’s the information in the pool.fastq. Guess it’s an index QC? I rushed to run the make.contigs like make.contigs(ffastq=Undetermined_S0_L001_R1_001.fastq, rfastq=Undetermined_S0_L001_R2_001.fastq) several hours ago and it’s still running. Perheps I can use trim.seqs() on the fasta file generated by make.contigs after make.contigs finished?
If the reads have primers and barcodes on them, why not trim them with the make.contigs command. Then you could follow the rest of the MiSeq_SOP. Here’s a link to Pat’s example analysis, http://www.mothur.org/wiki/MiSeq_SOP.
So you are saying you have barcodes for the forward reads, but no barcodes on the reverse reads. You have primers for the reverse reads, and no primers for the forward reads. The make.contigs command requires barcodes and primers to be paired.
Is mothur also outputting a bunch of “[WARNING]: did not find paired read for …, ignoring.”? This usually means the read names are different in the files. Are you sure you have the correct files?