mothur

chimera.perseus error

Hi!

I used the command “chimera.perseus” to check chimera of my denoised pyrosequencing data, but got a error tip. And the computer said it need to shut down Mothur because some problems.

The error tip was :
[ERROR]: N is not ATGC

Thank you for your time.

My name file is:
W4.Bac_1170 W4.Bac_1170,W4.Bac_1584
W4.Bac_5419 W4.Bac_5419,W4.Bac_4280,W4.Bac_2284,W4.Bac_4501,W4.Bac_4749,W4.Bac_5746,W4.Bac_3543,W4.Bac_5936,W4.Bac_6545,W4.Bac_7872,W4.Bac_7959,W4.Bac_8034,W4.Bac_8272,W4.Bac_8818,W4.Bac_3515,W4.Bac_5100,W4.Bac_5719,W4.Bac_5958,W4.Bac_6028,W4.Bac_6347,W4.Bac_7200,W4.Bac_7625,W4.Bac_7716,W4.Bac_8252,W4.Bac_8834,W4.Bac_8922
W4.Bac_2413 W4.Bac_2413

My fasta file is:

W4.Bac_1170
CGTGGCTCAGGATGAACGCTAGCGGGAGGCTTAACACATGCAAGTCGAACGGTAACAGGTCCTTCGGGATGCTGACGAGTGGCGGACGGGTGCGTAACGCGTATGCAACCTGCCTTTTACGAGGGGGATAGCCCATGGAAACGTGGATTAACACCCCATAATACTAATATTCTGCCTGGAATAATAGTTAAAACT
W4.Bac_5419
CGTGGCTCAGAGTGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGAGAACGGGTCTAGCTTGCTAGACTGTCAGCTAAGTGGCGGACGGGTGAGTAGTGTATAGTTAATCTGCCCTTTAGAGGGGGATAACAGTTAGAAATGACTGCTAATACCCCATACTCCTTTATACTTAATGTATATTGGGAAAGTTTTTTCGCTAAAGGATGAGACTATATGGTATCAGGTAGTTGGTGGGGTAAGAGCCTACCAAGCCAATGACGCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCGTACGGGAGGCCAGCGAGGTGGGGAATTAGTTGCACAATGGGGGAAACCCTGATGCAGCAACG
W4.Bac_5995
CGTGGCTCAGGATGAACGCTAGCGGCAGGCCTAACACATGCAAGTCGAGGGGTAACAGAGATTGCTTGCAATCTGCTGACGACCGGCGCACGGGTGCGTAACGCGTATAGAATCTACCTTATACTGAGGGATAGCCCAGAGAAATTTGGATTAATACCTCATGGTATGTATGAATGGCATCGTTCATACATTAAAGGTTACGGTATTAAGATGACTATGCGTCCTATTAGCTAGATGGTGTGGTAACGGCATACCATGGCAACGATA

Lily,

If you’ve denoised your sequences, there shouldn’t be any N’s in your sequences… When Quince wrote the code, he didn’t provide for a work around for when there are N’s in the sequences. We’ll work on this for a future release, but you might want to revisit how you’re denoising your sequences.

Pat