mothur

Trimming Adapters and Primers

Dear all,

I received 16S Amplicon raw data (containing adapters and primers) from the sequencing company. The sequences for the adapters and primers:

Bacterial 16S rRNA gene of the selected regions (16S V3-V4) were amplified using locus-specific
sequence primers with overhang adapters as below:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]

Bacterial 16S V3-V4 (5’ to 3’)
16S V3-V4 Forward: CCTACGGGNGGCWGCAG
16S V3-V4 Reverse: GACTACHVGGGTATCTAATCC

I’ve read the tutorial but am still confused on how to properly create the oligos files and to properly trim the sequences.

Can you post what you have in your olives file and how you’ve been trying to run make.contigs?

Pat

For my oligo file:
The file is named primerv3v4.oligos

Inside the file:
primer CCTACGGGNGGCWGCAG GACTACHVGGGTATCTAATCC

But this is what I get as output

Are you using version 1.44.3?