mothur

Split.groups missing destination file operand

Hello I’m having an issue with the split.groups command in mothur. Everything is formatted correctly the best I can tell. Take particular notice of line #6 below. This isn’t correct. The file name “Blackwel…” should come before .fasta. Any thoughts?

  1. mothur > split.groups(fasta = preplant.trim.contigs.trim.unique.abund.redundant.fasta , group = preplant.contigs.pick.abund.groups)

  2. Processing group: Blackwell_01_2_S381

  3. cp: missing destination file operand after ‘Blackwell_01_2_S381’

  4. Try ‘cp --help’ for more information.

  5. /******************************************/

  6. Running command: get.seqs(dups=f, fasta=preplant.trim.contigs.trim.unique.abund.redundant.fastaBlackwell_01_2_S381, accnos=preplant.contigs.pick.abund.Blackwell_01_2_S381.groups.accnos, name=Blackwell_01_2_S381)

  7. Unable to open Blackwell_01_2_S381. Trying default /home/jus1990/16s/Blackwell_01_2_S381.

  8. Unable to open /home/jus1990/16s/Blackwell_01_2_S381. Trying mothur’s executable location /home/jus1990/16s/Blackwell_01_2_S381.

  9. Unable to open /home/jus1990/16s/Blackwell_01_2_S381.

  10. Unable to open Blackwell_01_2_S381

  11. Segmentation fault

  12. jus1990@E052354:~/16s$ head preplant.trim.contigs.trim.unique.abund.redundant.fasta

  13. M02465_495_000000000-C6RM7_1_2110_10123_3617

  14. GACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTGCGACAAGTCGGGGGTGAAGTCTTTCGGCCCAACCGGAAAAGGGCCCCCGATACTGGCGCGCTGGAGGGAGGTAGGGGCATGTGGAACTCCAGGTGGAGCGGTGAAATGCGTAGATATCTGGAGGAACGCCGGTGGCGAAAGCGACGTGCTGGACCTTCTCTGACGCTGAGGCGCGAAAGCTAGGGGAGCAAACGGG

  15. M02465_495_000000000-C6RM7_1_2108_18759_4522

  16. GACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTGCGACAAGTCGGGGGTGAAGTCTTTCGGCCCAACCGGAAAAGGGCCCCCGATACTGGCGCGCTGGAGGGAGGTAGGGGCATGTGGAACTCCAGGTGGAGCGGTGAAATGCGTAGATATCTGGAGGAACGCCGGTGGCGAAAGCGACGTGCTGGACCTTCTCTGACGCTGAGGCGCGAAAGCTAGGGGAGCAAACGGG

  17. M02465_495_000000000-C6RM7_1_2112_5238_17620

  18. GACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTGCGACAAGTCGGGGGTGAAGTCTTTCGGCCCAACCGGAAAAGGGCCCCCGATACTGGCGCGCTGGAGGGAGGTAGGGGCATGTGGAACTCCAGGTGGAGCGGTGAAATGCGTAGATATCTGGAGGAACGCCGGTGGCGAAAGCGACGTGCTGGACCTTCTCTGACGCTGAGGCGCGAAAGCTAGGGGAGCAAACGGG

  19. M02465_495_000000000-C6RM7_1_1107_16010_5086

  20. GACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTGCGACAAGTCGGGGGTGAAGTCTTTCGGCCCAACCGGAAAAGGGCCCCCGATACTGGCGCGCTGGAGGGAGGTAGGGGCATGTGGAACTCCAGGTGGAGCGGTGAAATGCGTAGATATCTGGAGGAACGCCGGTGGCGAAAGCGACGTGCTGGACCTTCTCTGACGCTGAGGCGCGAAAGCTAGGGGAGCAAACGGG

  21. M02465_495_000000000-C6RM7_1_1108_13801_20124

  22. GACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTGCGACAAGTCGGGGGTGAAGTCTTTCGGCCCAACCGGAAAAGGGCCCCCGATACTGGCGCGCTGGAGGGAGGTAGGGGCATGTGGAACTCCAGGTGGAGCGGTGAAATGCGTAGATATCTGGAGGAACGCCGGTGGCGAAAGCGACGTGCTGGACCTTCTCTGACGCTGAGGCGCGAAAGCTAGGGGAGCAAACGGG

  23. jus1990@E052354:~/16s$ head preplant.contigs.pick.abund.groups

  24. M00385_68_000000000-BTHTN_1_1101_10323_5482 SW128_01_S339

  25. M02465_495_000000000-C6RM7_1_1111_7031_9003 SW63_05

  26. M02465_495_000000000-C6RM7_1_1111_7034_9021 SW63_05

  27. M00385_68_000000000-BTHTN_1_1101_10787_21940 SW58_09_S306

  28. M00385_68_000000000-BTHTN_1_1101_10784_21960 SW58_09_S306

  29. M00385_68_000000000-BTHTN_1_1101_11007_11785 SW128_01_S339

  30. M00385_68_000000000-BTHTN_1_2115_10705_4670 SW128_01_S339

  31. M02465_495_000000000-C6RM7_1_1113_13424_16444 SW63_02

  32. M02465_495_000000000-C6RM7_1_1111_18267_16035 SW63_02

  33. M02465_495_000000000-C6RM7_1_1111_18280_16050 SW63_02

Solved by using mothur 1.41.1 instead of 1.42.

There is a bug in split.groups command in version 1.42

Sorry - can you try again - we just reposted the correct 1.42.3 executable this morning and it should solve the problem.

This topic was automatically closed 10 days after the last reply. New replies are no longer allowed.