mothur

Removing Sequence Primers

Hello all,

I am new to MOTHUR and have just received a sequences from a MiSeq paired end run. The sequences had already been demultiplexed and had the barcode primers removed. However, the sequencing primers were not removed and I was given a file with the primers (515f and 806r) to the remove them. I am not sure how to do this.

I have tried using trim.seqs before and after make.contigs. When I use trim.seqs with my oligos file after make.contigs, I end up losing all of my sequences after the the filter.seqs step. When I use make.contigs followed by trim.seqs with my oligos file, Iater get a mismatch error after the unique.seqs step. I have also tried going from the make.contigs step through to the count.seqs step and then trimming the oligos but this causes MOTHUR to crash wen asked for a summary.

I’m not sure what is going on here, but any help would be greatly appreciated!

Thanks,

Jessie

Are your sequences in separate files, two for each sample? Have you tried running this for each sample:

mothur > make.contigs(ffastq=yourForwardFileSample1, rfastq=yourReverseFIleSample1, oligos=yourOligosfile, pdiffs=2)
mothur > make.contigs(ffastq=yourForwardFileSample2, rfastq=yourReverseFIleSample2, oligos=yourOligosfile, pdiffs=2)

Then you can make a group file and merged fasta file:

mothur > make.group(fasta=yourFastaFileSample1-yourFastaFileSample2…, groups=sample1-sample2…)
mothur > merge.files(input=yourFastaFileSample1-yourFastaFileSample2…, output=merged.fasta)

You can then continue with the MISeq SOP, http://www.mothur.org/wiki/MiSeq_SOP.

mothur > summary.seqs(fasta=merged.fasta)
mothur > screen.seqs(fasta=current, group=yourGroupFile, maxambig=0, maxlength=275)

Thank you for the fast reply. I did try that, but I still get an error about paired barcodes and primers. It looks like this:

mothur > make.contigs(ffastq=Acetate-T1-Anaerobic_S11_L001_R1_001.fastq,rfastq=Acetate-T1-Anaerobic_S11_L001_R2_001.fastq,oligos=miseq_oligos_sopformat.txt,pdiffs=2,processors=8)

Using 8 processors.
Reading fastq data…

119174
Done.

Processing Acetate-T1-Anaerobic_S11_L001_R1_001.0ffastatemp (file 1 of 1) <<<<<
[ERROR]: make.contigs requires paired barcodes and primers. You can set one end to NONE if you are using an index file.
Making contigs…
[WARNING]: your sequence names contained ‘:’. I changed them to ‘_’ to avoid problems in your downstream analysis.

mothur > make.contigs(ffastq=Acetate-T2-Anaerobic_S17_L001_R1_001.fastq,rfastq=Acetate-T2-Anaerobic_S17_L001_R2_001.fastq,oligos=miseq_oligos_sopformat.txt,pdiffs=2,processors=8)

Using 8 processors.
Reading fastq data…

I’ve tried formatting the oligos file in different ways but that does not seem to work either.

Thank you,

Jessie

Can you post your oligos file?

Hi,
I am having exactly the same problem. In my case, barcodes, indexes were removed by the sequencing facilities and I used degenerate primers, so I used all the possibles combinations, is that correct?. My oligo.files looks like this:

primer AAACTTAAAGGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTTAAAGGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTTAAAGGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTTAAAGGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTTAAATGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTTAAATGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTTAAATGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTTAAATGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTCAAAGGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTCAAAGGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTCAAAGGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTCAAAGGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTCAAATGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTCAAATGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTCAAATGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTCAAATGAATTGACGG ACGGGCGGTGTGTAC

Is this correct or should I add “imaginary” barcodes? I tried to make group and the error is:
556091
Done.

Processing BFP2_S13_L001_R1_001.0ffastatemp (file 1 of 1) <<<<<
[ERROR]: make.contigs requires paired barcodes and primers. You can set one end to NONE if you are using an index file.
Making contigs…
[WARNING]: your sequence names contained ‘:’. I changed them to ‘_’ to avoid problems in your downstream analysis.

Thanks!!

This is a bug that will be fixed in the next release. The issue is caused because your oligos file does not contain any barcodes. As a workaround add the following line to your oligos file:

primer AAACTTAAAGGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTTAAAGGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTTAAAGGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTTAAAGGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTTAAATGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTTAAATGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTTAAATGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTTAAATGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTCAAAGGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTCAAAGGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTCAAAGGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTCAAAGGAATTGACGG ACGGGCGGTGTGTAC
primer AAACTCAAATGAATTGGCGG ACGGGCGGTGTGTGC
primer AAACTCAAATGAATTGGCGG ACGGGCGGTGTGTAC
primer AAACTCAAATGAATTGACGG ACGGGCGGTGTGTGC
primer AAACTCAAATGAATTGACGG ACGGGCGGTGTGTAC
barcode none none myGroup

Mothur will remove the primers, and assign all your sequences to myGroup. You can disregard the group file mothur creates.