Hello team,
I have been having trouble finding the starting and ending sequence numbers to use for the pcr.seqs command.
I have followed previous explanations for how to use E. coli sequences to try to identify the point (including this nice step-by-step guide here), but using my primer data, my *.pcr.fasta file remained blank. I also tried using a different 16S bacteria file (B. fragilis) without results.
My primers: 8F, 338R
Sequences:
8F: AGAGTTTGATCCTGGCTCAG
338R: TGCTGCCTCCCGTAGGAGT
Both of these primers are aimed at the V2 region. Do I even need to align these primers using an E. coli reference file, or can I just use V2 region start/end sequence numbers? If so, does anyone happen to know what they are?
Lastly, I want to apologize in advance if this is a silly question. I am a novice at doing this.
Thank you!
-John