mothur

Make.contigs error code in scrap.fasta

Hi everyone,

We’d like to have some clarification on the error code in the scrap.fasta, following

make.contigs(file=batch_file, oligos=oligos_file, bdiffs=0, pdiffs=0, checkorient=t, insert=25, trimoverlap=f, allfiles=0)

We found most of the error codes falling into these 3 categories;

f(b)(bf)
b(bf)(bf)
bf(bf)(bf)

What exactly do they mean ? Our guess is that, i.e., for f(b)(bf), a barcode was found in the first direction, but not a primer, so it checked the second direction. In the second direction it could not find a barcode so the read failed with the “total error code” bf

Thanks for your help !

M00347_15_000000000-JNGG2_1_1102_3501_21352 | f(b)(bf) ee=7.17938e-06 fbdiffs=1000(noMatch), rbdiffs=1000(noMatch) fpdiffs=1000(noMatch), rpdiffs=1000(noMatch)
CCGGACATCCTTTCAGTTCCAGGGTTACCCTTTGCGCGGGCGATTTGAGCGTTAACGCTTCCGCGTTACGTAACTGCCGGGAGCTCTGGTAGACATACTCGATTTTCATCAAATCCCGGTTAGCGTTGCCGTCATGCCAGCGTTGGAAGACAAGCTGACCGCCAATCGGCGTTCTCTCATACTGG

M00347_15_000000000-JNGG2_1_1102_18979_12812 | b(bf)(bf) ee=1.82457e-06 fbdiffs=1000(noMatch), rbdiffs=1000(noMatch) fpdiffs=1000(noMatch), rpdiffs=1000(noMatch)
CGTCATTATTACGCCGGGGTATGGGATGGCGGTAGCGCAGGCGCAGTATCCGGTGGCGGAAATCACCGAAAAACTGCGCGCGCGCGGGATCAACGTGCGTTTCGGCATTCATCCGGTGGCGGGTCGCCTGCCGGGGCATATGAACGTGCTGTTGGCGGAGGCGAAAGTGCCTTATGACATCGTGCTG

M00347_15_000000000-JNGG2_1_1101_16655_7263 | bf(bf)(bf) ee=2.48811e-06 fbdiffs=1000(noMatch), rbdiffs=1000(noMatch) fpdiffs=1000(noMatch), rpdiffs=1000(noMatch)
AAACTCCTAAGCAGAAAACCTACCGCGCTTCGCTTGGTCAACCCCTCAGCGGCAAAAATTAAAATTTTTACCGCTTCGGCGTTATAACCTCACACTCAATCTTTTATCACGAAGTCATGATTGAATCGCGAGTGGTCGGCAGATTGCGATA

When the checkorient option is set to true mothur will try 3 ways to remove the barcodes and primers. The results of each attempt are reported unless a match is found. Consider this small example:

  1. Mothur will attempt to remove the barcodes and primers in the standard direction.

primer CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG
barcode ccaac ccaac sample1
barcode ggttg tcatc sample2
barcode ttggt ggaac sample3

  1. Mothur will try the reoriented barcodes and primers.

primer ATTACCGCGGCTGCTGG CCTACGGGAGGCAGCAG
barcode ccaac ccaac sample1
barcode tcatc ggttg sample2
barcode ggaac ttggt sample3

  1. Mothur will try the reversed barcodes and primers.

primer CCAGCAGCCGCGGTAAT CTGCTGCCTCCCGTAGG
barcode gttgg gttgg sample1
barcode gatga ccaac sample2
barcode gttcc accaa sample3

M00347_15_000000000-JNGG2_1_1102_3501_21352 | f(b)(bf) indicates that in the standard direction the barcode was removed but the primer (f) failed to be removed. In the reoriented direction the barcode (b) failed but the primer was removed. In the reversed direction both the barcode (b) and primer (f) failed.

1 Like