mothur

make.contigs Blank fasta name, ignoring read.


#1

I saw a similar question on the “issues” on git – but I didn’t see it here, so apologies, if I missed it.
I am running mothur v.1.39.5

I got all of my fastq files from the same run on the same machine, demultiplexed at the same time.

[WARNING]: Lengths do not match for sequence M70356:29:000000000-AW34K:1:1106:19514:13170. Read 251 characters for fasta and 136 characters for quality scores, ignoring read.[WARNING]: Lengths do not match for sequence M70356:29:000000000-AW34K:1:1106:19514:13170.
Read 251 characters for fasta and 136 characters for quality scores, ignoring read.[WARNING]: Blank fasta name, ignoring read.

Here is that fastq record for the 2 reads:
@M70356:29:000000000-AW34K:1:1106:19514:13170 1:N:0:35
TACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGCGTAAAGGGAGCGCAGGCGGCACGGCAAGTCCGGTGTGAAAGCCCGGGGCCCAACCCCGGGACTGCACTGGAAACTGCCGGGCTGGAGTGCCGGAGG
GGTAAGCGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCAGTGGCGGAGGCGGCTTACTGGACGGTCACTTACGCTGTGGCTCGAAAGCGTGGGGAGCAAAAA
+
AAAAACFAA2>>EEFEFGGGGGHGGGGGFBGHGHHHGGGGHHHGGGGGGEFGGFFGGGGGGCGGHBGGGDCGDHGFHGGGGGCFCCFAGDDDDFCGGGHGHGFHHGFBFFGGGGGGAGGGGGGFFGGGFAF-
@@ADFFFF->-AFFBFFFFFF9/:@DAD?/BBFFDD-;BFFFFFFFFEF…;BFDFFFFFFF;-;99;;-9@9BBFE/:;@D?D/://;9.9A.9;.;B@-;…BD.:@B;.;.A9/…

@M70356:29:000000000-AW34K:1:1106:19514:13170 2:N:0:35
CCTGTTTGCTCCCCACGCTTTCGAGCCTCAGCGTCAGTGACCGTCCAGTAAGCCGCCTCCGCCACTGGTGTTCCTCCTGATATCTGCGCATTTCACCGCTACACCAGGAATTCCGCTTACCCCTCCGGCACT
CCAGCCCGGCAGTTTCCAGTGCAGTCCCGGGGTTGGGCCCCGGGCTTTCACACCGGACTTGCCGTGCCGCCTGCGCGCCCGTTACGCCCAGTGGAGCCGGAGAACTCCCGCCCCCTACG
+
ABBAAFFFFBFFE?4A2E?FAFABBEEHHFB3BA2FEGHHHHGGGGGHGDG5FFEAEEE11B10EF3BFFGEHHDHFFFGGFFEGBF@E/EGHFGHH/><<<BFCE0?FG2GFF2CGG?GHHHGEDAA/@CB
0CC><>EC----<=DFHFFGFE0FGBCGCC-:9-B–9.;-?-A->./;///B.@–9@/;9B-:@?E9–.9.----;–;9.9…–…////9.;-----./9//;.------.;.


Then this error repeated: [WARNING]: missing sequence for , ignoring.[WARNING]: expected a name with + as a leading character, ignoring.[WARNING]: missing qua lity for , ignoring.[WARNING]: Blank fasta name, ignoring read.
And it seems to be stuck there... Any ideas?

#2

Are you using the files as generated by the MiSeq or are they being processed between being generated and coming into mothur? If they’re getting pre-processed somehow, can you use the raw reads instead?

Pat


#3

These are fastq files that are being sent by the sequencing core – I asked and they use bcl2fastq 2.17 to demultiplex. I am not sure what you mean by raw reads.


#4

I saw on the git issues, that someone else said that it was fixed by gunzipping and gzipping the fastq files – this seemed to fix my problem too.