I am trying to demultiplex data from a Minion run with an oligo file (dual barcode tagging like “barcode AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT gr1_rep3”) but I don’t know which command I can feed this file to as make.contigs is not an option.
I tried trim.seqs but it did not work. Is there a way to do this in mothur?
Thanks! The sequences need to start and end with the barcode and primer. Yours currently has an adapter or some other sequence before the barcode/primer starts and after the reverse barcode/primer ends. Those bits will need to be removed. Also, your reverse barcode/primer need to be provided as the reverse compliment in the oligos file.