Demultiplexing Minion data

Hello

I am trying to demultiplex data from a Minion run with an oligo file (dual barcode tagging like “barcode AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT gr1_rep3”) but I don’t know which command I can feed this file to as make.contigs is not an option.

I tried trim.seqs but it did not work. Is there a way to do this in mothur?

Thanks

I think it should be trim.seqs. Can you post an example of a sequence that has the barcodes/primers you are hoping to remove with the oligo file?

Pat

here are a couple:

d4d0a1e7-2864-4914-968f-7c0f5b6c0ff8
TATGTCACTCTACTTCGTTCAGTTACGTATTGCTAAGGTTAAAGGTCTACCTCGCTAACACCACTGCAGCACCTGTGCCAGCAGCCGCGGTTACACGATTAACCCAAGCTAACAGGAGTACGGCGTAAAACGTGTTAAAGCACCATACCAAATAGGGTTAAATTCTAACTAAGCTGTAAAAAGCCATGATTAAAATAAAAATAAATGACGAAAGTGACCCTACAATAGCCGACGCACTATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATAGGTGCTGCAGTGGTGTTAGCGAGGTAGACCTTTAACCTTAGCAATAA
52d80b70-9d5f-450a-ba87-0ecf76582aa8
GTTATGTCCTGTTACTTCGTTCAGTTACGTATTGCTAAGGTTAAAGGTCTACCTCGCTAACACCACTGCAGCACCTAGTGGGGTATCTAATCCTAGTTTGGGTCTTAGCTATAGTGCGTCGGCTATTGTAGGGTCACTTTCGTCATTTATTTTTATTTTAATCATGGCTTTTTACAGCTTAGTTAGAATTTAACCCTATTTGGTATGGTGCTTTAACACGTTTTACGCCGTACTCCTGTTAGCTTGGGTTAATCGTGTGACCGCGGCCGCTGGCACAGGTGCTGCAGTGGTGTTAGCGAGGTAGACCTTTAACCTTAGCAATACG

Thanks! The sequences need to start and end with the barcode and primer. Yours currently has an adapter or some other sequence before the barcode/primer starts and after the reverse barcode/primer ends. Those bits will need to be removed. Also, your reverse barcode/primer need to be provided as the reverse compliment in the oligos file.

Pat

ok I’ll trim these adapters and include the primers in the oligo file. Thanks!