Hi all,
I apologize if this is the wrong section of the forum that I am posting in. I am a new user for mothur, and am having trouble installing it and running it. I unzipped mothur into my home folder of my mac (macbook), and I think it installed correctly. When it comes to combining data or analyzing data, how do I begin to do it? Do I have to transfer my data files INTO the mothur folder? How do I create a batchfile for my data? I am new to C++ and terminal, so any help would be greatly appreciated.
Ps. I ran my samples on a MiSeq desktop sequencer.
Thank you!
Welcome to the mothur community! You may find this thread helpful, Running a script from command line Also, be sure to check out the wiki, http://www.mothur.org/wiki/Main_Page and Pat’s example analysis’ http://www.mothur.org/wiki/454_SOP and http://www.mothur.org/wiki/MiSeq_SOP.
Thank you. I am slowly learning this. I was able to get mothur to make contigs, however when I try to remove the primer/barcode it gives me an error. I do NOT have an fna file and I made my own oligo file (following the same template as the example Pat has in the wiki). It gives me this error:
[WARNING]: This command can take a namefile and you did not provide one. The current namefile is SV003-001_S2_L001_R1_001.trim.contigs.names which seems to match SV003-001_S2_L001_R1_001.trim.contigs.good.summary.
[WARNING]: {\RTF1\ANSI\ANSICPG1252\COCOARTF1265\COCOASUBRTF210 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring {\FONTTBL\F0\FMODERN\FCHARSET0.
[WARNING]: COURIER;\F1\FNIL\FCHARSET0 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring CAMBRIA;}.
[WARNING]: {\COLORTBL;\RED255\GREEN255\BLUE255;\RED247\GREEN247\BLUE247;} is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \MARGL1440\MARGR1440\VIEWW10800\VIEWH8400\VIEWKIND0.
[WARNING]: \DEFTAB720 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \PARD\PARDEFTAB720\SL320.
[WARNING]: \F0\FS26 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \CF0.
[WARNING]: \CB2 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring FORWARD.
[WARNING]: \F1\FS24 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \CB1.
[WARNING]: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGACAGAAAGACCCTATGAA is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring P23SRV_F1.
[WARNING]: \F0\FS26 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \CB2.
[WARNING]: \ is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring REVERSE.
[WARNING]: \F1\FS24 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \CB1.
[WARNING]: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGCCTGTTATCCCTAGAG is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring P23SRV_R1.
[WARNING]: \F0\FS26 is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring \CB2.
[WARNING]: \ is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring BARCODE.
[WARNING]: GCGTAAGA is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring S517.
[WARNING]: \ is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring .
[WARNING]: } is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring .
[ERROR]: cannot mix paired primers and barcodes with non paired or linkers and spacers, quitting.
Any idea what I am doing wrong?
It looks like you may have given mothur the summary file instead of the fasta file, and the oligos file is not in the right format. Here’s a link to what mothur expects in the oligos file, http://www.mothur.org/wiki/Oligos_File. Can you post the command you ran? Also, if you set the debug flag using the set.dir command before you run trim.seqs you can see what mothur is reading in the oligos file.
mothur > set.dir(debug=t)