mothur

trim.seqs problem


#1

Hello,
I have a problem with trim.seqs command. I used this:
trim.seqs(fasta=SP.vsearch.name.fasta, oligos=Paired_barcodes.txt, processors=4, checkorient=t)
and oligos file:
forward TTGTTACTAGGGGAATCCTTGTT
forward AACCGCCAGATTCACACATTGA
reverse GGCATYGARTYKTTGAACGCA
barcode ACGAGTGCGT 1_SP
barcode ACGCTCGACA 2_SP
barcode AGACGCACTC 3_SP
barcode ACTCGCGTGTC 4_SP
barcode ATGATACGTCT 5_SP
barcode ACGAGAGATAC 6_SP
barcode ATACGACGTA 7_SP
barcode ATCACGTACTA 8_SP
barcode ACGTCTAGTAC 9_SP
barcode ATGTACTACTC 10_SP
barcode ACATACGCGT 11_SP
barcode ACTACTATGT 12_SP
barcode ACTGTACAGT 13_SP
barcode AGACTATACT 14_SP
barcode AGTACGCTAT 15_SP
barcode ATAGAGTACT 16_SP
barcode ACACGCTACGT 17_SP
barcode ACAGTAGACGT 18_SP
barcode ACGACGTGACT 19_SP
barcode ATACACACACT 20_SP
barcode ATACACGTGAT 21_SP
barcode ATACAGATCGT 22_SP
barcode ATACGCTGTCT 23_SP
barcode ATAGTGTAGAT 24_SP
barcode ATCGATCACGT 25_SP
barcode ATCGCACTAGT 26_SP
barcode ATCTAGCGACT 27_SP
barcode ATGACGTATGT 28_SP
barcode ATGTGAGTAGT 29_SP
barcode AACAGTATATA 30_SP
barcode ACTAGCAGTA 31_SP
barcode AGTATACATA 32_SP
barcode AGTCGAGAGA 33_SP
barcode AGTGCTACGA 34_SP
barcode ACGATCGTATA 35_SP
barcode ACGCAGTACGA 36_SP
barcode ACGCGTATACA 37_SP
barcode ACGTACAGTCA 38_SP
barcode ACGTACTCAGA 39_SP
barcode ACTATAGCGTA 40_SP
barcode ATACGTCATCA 41_SP
barcode ATAGTCGCATA 42_SP
barcode ATATGCTAGTA 43_SP
barcode ATCACGCGAGA 44_SP
barcode AGTGTATGTC C-soil
barcode AGTAGTGATC C-PCR
barcode ATATAGTCGC MOCK

However, the sample codes in generated groups file are mixed, for example all sequences (or all that I have controlled) from MOCK sample are affixed to 37_SP sample, and sequence from 37_SP to sample 23_SP and so on… I know it because 1) have control barcode directly in fasta file, and 2) when I filter only one sample, it is affixed correctly, see example from .groups file here:
All samples:
………
SP1584004 37_SP
SP1584005 4_SP
SP1584007 8_SP
SP1584008 21_SP
SP1584011 3_SP
SP1584012 8_SP
SP1584019 43_SP
SP1584021 6_SP
SP1584023 38_SP
SP1584027 1_SP
SP1584031 C-soil
SP1584032 18_SP
SP1584037 12_SP
SP1584038 3_SP
SP1584039 39_SP
SP1584040 20_SP
SP1584041 37_SP
SP1584043 32_SP
…….
Only MOCK sample:
……
SP1584004 MOCK
SP1584041 MOCK

I have found, that it works correctly without forward and reverse primers (only with barcode) in oligo file. Could you help me?
All Best
Milan


#2

Could you send your input files and log file to mothur.bugs@gmail.com so I can take a closer look for you?