- Creation of custom reference alignment from the downloaded UNITE’s mothur-compatible sequences went okay.
- However, align.seqs() results in error.
===> [ERROR]: template is not aligned, aborting.
[ Please see details shown below. ]
Question: How to make UNITE’s-mothur-compatible database work for 18S mothur analysis.
Thanks a lot in advance.
=== The Details ===
A. Downloaded UNITE’s mothur release from: https://unite.ut.ee/repository.php.
B. pcr.seqs()
mothur “#pcr.seqs(inputdir=./space4_18S/, fasta=UNITE_public_mothur_full_20.11.2016.fasta, oligos=oligos.file_18S_rewrite, keepdots=F, keepprimer=F, processors=8)”
C. Oligos file
Contents of oligos.file_18S_rewrite
forward TCCGTAGGTGAACCTGCGG
reverse TCCTCCGCTTATTGATATGC
D. Summary after pcr.seqs
mothur “#summary.seqs(inputdir=./unite_mothur/, fasta=UNITE_public_mothur_full_20.11.2016.pcr.fasta, processors=8)”
Start End NBases Ambigs Polymer NumSeqs
Minimum: 1 1 1 0 1 1
2.5%-tile: 1 447 447 0 4 1368
25%-tile: 1 516 516 0 5 13675
Median: 1 554 554 0 6 27349
75%-tile: 1 617 617 0 7 41023
97.5%-tile: 1 719 719 2 10 53330
Maximum: 1 1664 1664 553 553 54697
Mean: 1 568.07 568.07 0.288005 6.34867
of Seqs: 54697
E. align.seqs()
mothur “#align.seqs(inputdir=./unite_mothur/, fasta=s4_18s.trim.contigs.good.unique.fasta, reference=unite_mothur_its.fasta, processors=8)”
Reading in the /<ANALYSIS_PATH>/unite_mothur_its.fasta template sequences… [ERROR]: template is not aligned, aborting.