pcr.seqs : i dont find the primers in reference database

Commands in mothur
1

Hello,

I have searched if any topic related to my problem existed but didn’t find any. Sorry if I missed it.

I have illumina pair-end fastq files (using V1-V3), so it is 2 separated files. Using make.contigs(ffastq=file1.fasq, rfastq=file2.fastq), i make the overlapping and then with trim.seqs i remove the primers. i used screen.seqs to filter the contigs (maxambig=0, minlength=450, maxlength=550)… And unique.seqs function, to have only unique sequences.

Before to align my contigs, i use the database silva.nr_v123.align. For this, i decide to use pcr.seqs in order to work only with the region V1-V3. Here is the command

pcr.seqs(fasta=silva.nr_v123.align,oligos=oligo)

My oligo file looks like this :
primer AGAGTTTGATCCTGGCTCAG ATTACCGCGGCTGCTGG

My primers are needed to amplify V1-V3.
forward reference : 27f
reverse reference : 534r

However i only have 2 seqs left after this, I don’t get it at all. Does it mean my primers are not present in the databse ? How is it possible ?


Thanks to help me out with this.
2

We don’t include positions 1-27 in the silva databases since they’re rarely really sequenced and can’t be trusted. [ Aside: when we sequence that region for amplicons, we are sequencing primer, not bacterial DNA. The only time you’d sequence those bases is in a genome. ] So, to do what you want, you should leave off the forward primer.

Pat