Hi there,
I’m having trouble running make.contigs on paired-end miseq 515/806 data due to some paired reads having a different amount of bases/scores (by 1).
When run as make.contigs(ffastq=Sam78-125_S3_L001_R1_001.fastq, rfastq=Sam78-125_S3_L001_R2_001.fastq, processors=16)
[WARNING]: For sequence M02542:42:000000000-ABVHU:1:2116:14191:7488 I read 300 quality scores from Sam78-125_S3_L001_R1_001.fastq, but read 301 quality scores from Sam78-125_S3_L001_R2_001.fastq, ignoring.
[WARNING]: For sequence M02542:42:000000000-ABVHU:1:2116:14856:7488 I read a sequence of length 300 from Sam78-125_S3_L001_R1_001.fastq, but read a sequence of length 301 from Sam78-125_S3_L001_R2_001.fastq, ignoring.
[WARNING]: For sequence M02542:42:000000000-ABVHU:1:2116:14856:7488 I read 300 quality scores from Sam78-125_S3_L001_R1_001.fastq, but read 301 quality scores from Sam78-125_S3_L001_R2_001.fastq, ignoring.
I get many of these; apparently millions of my sequences are the problem. I’ve been looking around for how to circumvent this or trim one base off the larger ones but they are not all in the same orientation and I’m not good enough at coding to write a simple script to orient and then cut one. I also haven’t had any success searching online.
Has this come up? Is there an easy fix?
Thanks for any info
Mike
Could you post the results of these two commands (assuming you’re on mac/linux)…
grep -A 4 "M02542:42:000000000-ABVHU:1:2116:14191:7488" Sam78-125_S3_L001_R1_001.fastq
grep -A 4 "M02542:42:000000000-ABVHU:1:2116:14191:7488" Sam78-125_S3_L001_R2_001.fastq
Sure thing!
Michaels-MacBook-Pro:100914ML515F-17540529 Mike_Lee$ grep -A 4 “M02542:42:000000000-ABVHU:1:2116:14191:7488” Sam78-125_S3_L001_R1_001.fastq
@M02542:42:000000000-ABVHU:1:2116:14191:7488 1:N:0:3
GAGTACTCGTGCCAGCCGCCGCGGTAATACGGAGGGATCGAACGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGATAAGTGGGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTCCAAACTGTCAAACTAGAGTATGGTAGAGGGTGGTAGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAATACCGATGGCGAAGGCAGCCACCTGGACCAATACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCGTGTAGTCC
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG,@FGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGDEGGGGGGGGGGGGGG;EGGFGGGFGGGBF@GFFFFGGGG;>>FGDFGD
@M02542:42:000000000-ABVHU:1:2116:14856:7488 1:N:0:3
Michaels-MacBook-Pro:100914ML515F-17540529 Mike_Lee$ grep -A 4 “M02542:42:000000000-ABVHU:1:2116:14191:7488” Sam78-125_S3_L001_R2_001.fastq
@M02542:42:000000000-ABVHU:1:2116:14191:7488 2:N:0:3
GGACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGCGTCAGTATTGGTCCAGGTGGCTGCCTTCGCCATCGGTATTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCTACCACCCTCTACCATACTCTAGTTTGACAGTTTGGAATGCAGTTCCCAGGTTAAGCCCGGGGCTTTCACATCCCACTTATCAAACCGCCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGTTCGATCCCTCCGTATTACCGCGGCGGCTGGCACGAGTACTCC
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGEGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGFBGDGCDEGGGGGGGGGFF??GFGFGFGFEDCBFFGDFAFGFFGG9BDB@>GFBF;<40>B;9CEBD>:>::AAA(
@M02542:42:000000000-ABVHU:1:2116:14856:7488 2:N:0:3
Just in case it helps figuring out what’s going on here or the info is useful to you guys - if I make a stability file with the same raw fastq files as above, and then run make.contigs with the stability file as input, there doesn’t seem to be a problem for some reason
mothur > make.contigs(file=Dorado.files, processors=3)
It took 5925 secs to process 5887653 sequences.
Group count:
Dorado_All 5887653
Total of all groups is 5887653
Output File Names:
Sam78-125_S3_L001_R1_001.trim.contigs.fasta
Sam78-125_S3_L001_R1_001.scrap.contigs.fasta
Sam78-125_S3_L001_R1_001.contigs.report
Sam78-125_S3_L001_R1_001.contigs.groups
What version of mothur are you using?
Ah, sorry, should have included that. This was on v.1.29.1
Can you try with the latest version of mothur? We’re up to v.1.34 and I’m not immediately remembering what state make.contigs was back in 1.29.
Sorry, just got around to trying it. It works just fine in v 1.33.3. Thanks!