Hello all, I need your help. My samples are soil samples and I have amplified the archaea V6-V8 region from 16S rRNA genes using the following primers.
Ar915aF: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGGAATTGGCGGGGGAGCAC/
Ar1386R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCGGTGTGTGCAAGGAGC.
I have been getting problems after I run screen.seqs, my number of sequences gets very low. For example:
mothur >
summary.seqs(fasta=stability.trim.contigs.unique.align,count=stability.trim.contigs.count_table)
Using 12 processors.
Start End NBases Ambigs Polymer NumSeqs
Minimum: 0 0 0 0 1 1
2.5%-tile: 1044 1062 7 0 2 18492
25%-tile: 28439 42539 272 0 5 184914
Median: 28439 42539 488 0 5 369827
75%-tile: 28439 42539 490 0 5 554740
97.5%-tile: 43102 43116 492 0 7 721161
Maximum: 43116 43116 500 0 8 739652
Mean: 28266 38971 372 0 4
# of unique seqs: 489714
total # of seqs: 739652
It took 192 secs to summarize 739652 sequences.
Output File Names:
stability.trim.contigs.unique.summary
Then I run
mothur > screen.seqs(fasta=stability.trim.contigs.unique.align,count=stability.trim.contigs.count_table, start=28439, end=43116)
mothur > summary.seqs(fasta=current, count=current)
Using stability.trim.contigs.good.count_table as input file for the count parameter.
Using stability.trim.contigs.unique.good.align as input file for the fasta parameter.
Using 12 processors.
Start End NBases Ambigs Polymer NumSeqs
Minimum: 28439 43116 465 0 5 1
2.5%-tile: 28439 43116 465 0 5 1
25%-tile: 28439 43116 466 0 5 2
Median: 28439 43116 466 0 5 4
75%-tile: 28439 43116 466 0 6 6
97.5%-tile: 28439 43116 466 0 7 7
Maximum: 28439 43116 466 0 7 7
Mean: 28439 43116 465 0 5
# of unique seqs: 7
total # of seqs: 7
It took 0 secs to summarize 7 sequences.
Output File Names:
stability.trim.contigs.unique.good.summary
I am not sure why my number of sequences gets very low. Is there something I can do to fix it? Thank you for all your help!