align output

Commands in mothur
1

Hi Everyone,
Could anyone explain me or direct to some paper that explains the difference between aligned and unaligned database. Also, could anyone explain me the output of align.seqs() command.
I have this output
…
…
…
…
…
…
…
…
…T-------AC—GT-AG-GGT------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------------------------------------------------------------GCG
-A-G---------------------------------------------------------------------------------------------------------------------------------------------------------

---------------------------C–G--T—T–AA-T-CGG-AA------TT-A–C-T–GG-GC------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------GT–A-----AA-GC-GT-GC-------G-CA-G-G-C-G---------------G–T-TA-T-A-T—

-----------------AA----G-A-C-A-----------------------------------------------------G-T-T–G--TG–A-AA-TC–C-C-CG-G-G-----------------------------------------
-----------------------------------------------------------------------------------------------------CT-C-AA-------------------------------------------------
---------------------------------------------------------------------------------------------------------------C-C-T-G-G-G-A–A-T----T-G–C-A—T–C---------
-------------------T–GT-G-A—C----------------------------------------------------T–G-T–AT–A-G-C--------------------------------------------------------

------------------------------------------------------------------------------T-A-G-A-G-T–A-----C-GG------TA-G-A---------------------G-G-G-G—GA-T---------

-------------------------------------------------------------------------------GG–A--ATT--------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------C-C-G-C-GT…
…
…
…
…
…
…
There are more dots at the starting and at the end, I have not provided all due to space.
How there are so many hyphens in between.
Thanks for any help!!!

2

dots=beginning and end of sequence / missing data
dashes = gaps in alignment

the 50k column alignment is so that 16S and 18S can be compared on the same alignment with plenty of room for padding.

3

Thanks Dr. Schloss,
Why the is not a stretch of sequence match like this
…
…
…
…TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAATTGCATCTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCGT…
…
…
…
…
…
in the align.report file I am getting 100% similarity b/w querry and template, then why so many gaps in between bases like
---------------------------C–G--T—T–AA-T-CGG-AA------TT-A–C-T–GG-GC------------------------------------------------------------------------------------

Thanks!!!

4

Because it’s an alignment… To preserve positinoal homology across all sequences you have to insert gaps.

5

Thanks Dr. Schloss,
I am sorry but I am still not able to understand. As far as I understand if there is 100 % similarity the it should be like this
TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAATTGCATCTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAAT

but why there are so many gaps.

It would be great if you could provide some reference so that I am able to get better. I am a biology student and first time dealing with bioinformatics.


Thanks for all the help!!!!
6

Because there’s more than two sequences in the world :). I’d encourage you to read up on multiple sequence alignment. The gaps are there because of the tremendous genetic diversity in the 16S gene across bacteria.