I am hoping to be able to use what was done with the V4 primers to design other constructs.
In using custom sequencing primers, does it matter as to which sequencing read is chosen for the index primer? In Kozich’s recent MiSeq paper, the index primer was simply the reverse complement of the reverse sequencing primer (read 2), but is there any reason as to why it cannot be the read 1 primer?
Also, is there any scenario where it would be necessary to have 2 index sequencing primers?
Many thanks for any insight that could be provided.
In using custom sequencing primers, does it matter as to which sequencing read is chosen for the index primer? In Kozich’s recent MiSeq paper, the index primer was simply the reverse complement of the reverse sequencing primer (read 2), but is there any reason as to why it cannot be the read 1 primer?
Because the sequencing is done in the opposite direction for the index sequencing. That’s why you need the reverse compliment of that primer.
Also, is there any scenario where it would be necessary to have 2 index sequencing primers?
I can’t think of one. The priming for the second index sequence comes off the lawn on the plate and makes use of the default sequence.
In the Nextera.txt (and Schloss) SamplePrepKits, the adapter is specified as CTGTCTCTTATACACATCT but I can’t figure out where that sequence comes from. Since the forward adapter is AATGATACGGCGACCACCGAGATCTACAC and the reverse CAAGCAGAAGACGGCATACGAGAT, I don’t quite understand the relevance of that sequence in the .txt file.