how to select minimum and maximum length of reads from summary seqs

Theory behind mothur
1

Dear folks,

I am new to analyze for micro biome data. I am trying to use mothur for my analysis. I have MiSeq paired (fastq) microbiome data. After using contigs and summary.seqs command i need to screen the sequences from my reads. The sumary file look like this:

    mothur > summary.seqs(fasta=stability.trim.contigs.fasta)
    
    Using 2 processors.
    
      Start End NBases Ambigs Polymer NumSeqs
    Minimum: 1 35 35 0 3 1
    2.5%-tile: 1 290 290 0 4 98245
    25%-tile: 1 458 458 0 4 982449
    Median:  1 460 460 1 6 1964897
    75%-tile: 1 465 465 4 6 2947345
    97.5%-tile: 1 466 466 22 7 3831548
    Maximum: 1 602 602 59 289 3929792
    Mean: 1 450.165 450.165 3.55126 5.35893
    # of Seqs: 3929792
    
    Output File Names: 
    /Users/Destiny/Desktop/MicroBiome/OurData/stability.trim.contigs.summary

This point i need to select my minimum and maximum length in order to run screen.seqs but seeing summary output i am confused to select these lengths due to i read that microbiome reads supposed to have 250-300 bp and here i am seeing maximum length is about 600bp.
please help.

2

What did you sequence? I’m guessing you did v4-6 rather than just v4?

3

dear kmitchell,

The sequencing was done using V3-V4 (for bacteria and archaea - Takahashi et al. 2014). Here i like to ask one more thing. As sequenced was done using forward and reverse primers so i need to clip these adapters using such as cutadpat program and then use mothur or i should not bother about trimming adapters before mothur?

We used illumina standard primers which are:

adapter F: TCGTCGGCAGCGTCAGATGTGTATAAGAGA
adapter R: GTCTCGTGGGCTCGGAGATGTGTATAAGAG

pro341F CCTACGGGNBGCASCAG
pro805R GACTACNVGGGTATCTAATCC

Reference (table 1)

http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0105592#pone-0105592-t001

Thanks in advance

4

Did you use custom sequencing primers (al.la Kozich/Caporasso) or illumina standard? Custom primers generally mean that pcr primers aren’t sequenced, standard primers mean pcr primers are sequenced.

5

to answer you original question, I’d trim above 465 or 470 and below 400. Not sure about minimum, v4 usually doesn’t need a min length trim

6

Thank you for your kind reply i would go with your suggestion and take only maximum length for screen.seqs. Moreover please take a look of my second question regarding primers/adpater triiming, i have just updated.

Thanks once again and looking forward for your answer/view regarding trimming apadters along with quality (>20) prior using mothur.

Note: the idea was found in this paper:

“The V4-V5 Illumina datasets were initially demultiplexed using MiSeq Reporter v2.0. The sequences corresponding to the forward and reverse primers were trimmed from the demultiplexed reads using cutadapt (http://code.google.com/p/cutadapt/) using similar stringency settings to those used for the 454 sequences. The trimmed read pairs were then merged into single contigs using SeqPrep (https://github.com/jstjohn/SeqPrep) followed by a length-filtering step prior to analysis with QIIME. The Illumina V4 read pairs were merged and length filtered in a similar manner as the V4-V5 reads to form single contigs prior to being demultiplexed with QIIME. Reads from all datasets were quality filtered using a Q20 minimum value during demultiplexing.”

7

You can trim the primers using the make.contigs command with an oligos file, https://mothur.org/wiki/Oligos_File#Paired_Primers. The make.contigs command also has parameters to allow you to trim using the quality scores, https://mothur.org/wiki/Make.contigs#insert and https://mothur.org/wiki/Make.contigs#deltaq.