Hi, all. We amplified the V5-V7 region of 16srRNA with our root samples using the primers (799F) AACMGGATTAGATACCCKG and (1193R) ACGTCATCCCCACCTTCC. I tried to find the co-ordinates in Silva bacteria to align my sequences but each time I try to customize it, my mothur closes. Any idea on the start and end points to align my V5-V7 sequences?
Hi Ananta,
Are you following this tutorial?
Can you post how far you’ve gotten before you run into problems?
Thanks,
Pat
Dr Pat,
Yes I am following the protocol. Even just now, I along with a professor of Molecular Biology here at USU tried but the same happened.
I have attached herewith the screenshot of the problem.
Regards
Can you post the contents of the fasta file you are trying to align?
I have attached herewith the the e coli fasta which I obtained from https://www.ncbi.nlm.nih.gov/nuccore/174375?report=fasta ; along with list of primers and the E coli V5-V7 fasta which I used to align. The forward primer ends at 798th base and the reverse primer ends at 1176th base and hence the sequence I used is from 799th to 1175th base.
(Attachment ecoli.fasta.txt is missing)
(Attachment ecoli_V5-V7.fasta.txt is missing)
(Attachment V5-V7.oligos.txt is missing)
I think the previous attachments failed. So, I have attached here with a word file of the same.
Regards
(Attachment V5-V7.docx is missing)
gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga
gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga
The first line needs to start with a > followed by the name of the sequence…
> ecoli
gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtc
gaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagc
atgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtg
ccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaac
gagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga
Is it not possible to align our sequences to whole silva bacteria , I could not proceed to find out the co-ordinates I required for aligning V5-V7 region. I left the computer on for whole night and there was no progress at all.
Can you post everything you’ve done starting from the beginning? I can’t see what you’re doing and your descriptions aren’t clear enough for me to understand where you are getting hung up. Could you possibly attach ecoli_V5-V7.fasta.txt?
Pat
I am trying to find the co-ordinates in silva bacteria to align my V5-V7 amplified 16srRNA sequences. Let me make clear what I did:
I obtained the E coli 16sr RNA from the link here Escherichia coli 16S ribosomal RNA, complete sequence - Nucleotide - NCBI, and I trimmed the E coli 16srRNA sequence using the 799F (AACMGGATTAGATACCCKG) and 1193R (ACGTCATCCCCACCTTCC). Then the resulting E coli V5-V7 fasta.txt was used to align against the silva.bacteria.fasta and also against silva.seed_v123. Doing that, the Mothur proceeded to some steps and after that I could only see a vertical stack of 0’s (zeros) in the left corner of my computer screen for 4-5 hours; still I left the computer on for the whole night but the step did not proceed.
The ecoli-V5-V7.fasta I used was
ecoli
gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga
I’m not sure what was going wrong for you. Were you perhaps saving ecoli-V5-V7.fasta in word? Regardless, here’s what I got…
mothur > align.seqs(fasta=ecoli-V5-V7.fasta, reference = silva.bacteria.fasta)
Using 10 processors.
Reading in the silva.bacteria.fasta template sequences... DONE.
It took 11 to read 14956 sequences.
Aligning sequences from ecoli-V5-V7.fasta ...
1
It took 0 secs to align 1 sequences.
It took 1 seconds to align 1 sequences.
Output File Names:
ecoli-V5-V7.align
ecoli-V5-V7.align_report
mothur > summary.seqs()
Using ecoli-V5-V7.align as input file for the fasta parameter.
Using 10 processors.
Start End NBases Ambigs Polymer NumSeqs
Minimum: 25292 37693 377 0 5 1
2.5%-tile: 25292 37693 377 0 5 1
25%-tile: 25292 37693 377 0 5 1
Median: 25292 37693 377 0 5 1
75%-tile: 25292 37693 377 0 5 1
97.5%-tile: 25292 37693 377 0 5 1
Maximum: 25292 37693 377 0 5 1
Mean: 25292 37693 377 0 5
# of Seqs: 1
It took 0 secs to summarize 1 sequences.
Output File Names:
ecoli-V5-V7.summary
I saved it in text file in the same folder where I have mothur files. Anyways, thank you very much Pat, I appreciate your help so much. You are the best .