# trim.seqs oligos

**URL:** <https://forum.mothur.org/t/trim-seqs-oligos/1314>\
**Category:** Commands in mothur\
**Created:** [April 20, 2013, 8:26am UTC](https://forum.mothur.org/t/trim-seqs-oligos/1314 "2013-04-20T08:26:05Z")\
**Posts on this page:** 4\
**Page:** 1

<div class="post-metadata">

**Author:** ![jenz](https://avatars.discourse-cdn.com/v4/letter/j/4bbf92/32.png) [@jenz](https://forum.mothur.org/u/jenz)\
**Post date:** [April 20, 2013, 8:26am UTC](https://forum.mothur.org/t/trim-seqs-oligos/1314/1 "2013-04-20T08:26:05Z")

</div>

Hi,  
I have got a fasta file that which seem to contain some overrepresented sequence bits in it. (Seems that some sequences have got adapters still clinging to them).So I thought trim.seqs should take care of removing those oligos from sequences, or will they just remove all sequences containing these oligos?  
I have tried both to put those two oligos into oligo files as primers and as barcodes.

example. run 1.  
pcr.seqs(fasta=IValgus.fastq.keep.below, oligos=ollikad, processors=8)  
where ollikad is a file  
forward GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC  
forward AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG  
and run 2.  
where ollikad is a file  
barcode GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC TRUSEQ1  
barcode AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG TRUSEQ2

Both of the runs will result with empty trim.file and all sequences being sorted to scrap.file.  
As a matter of fact the run which had these oligos tagged as barcodes, will add |b at the end of the sequence names in scrap.file not group names TRUSEQ1 or 2.  
What is going on? Can I somehow still use the trim.seqs or pcr.seqs to accomplish my task? \*What did I do wrong, or is there some bug?  
The version information for these runs is.  
64Bit Version  
mothur v.1.28.0  
Last updated: 11/2/2012

  
\*The task being to remove these oligos from my sequences.

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [April 20, 2013, 11:24am UTC](https://forum.mothur.org/t/trim-seqs-oligos/1314/2 "2013-04-20T11:24:17Z")

</div>

Hi Jenz,

I think you need to double check what you’re trying to do. These seem to contain the Illumina TrueSeq adapters and barcodes. If you’re doing Illumina sequencing, then you shouldn’t have the adapter/barcode/primer sequences. So, I’m not clear what you want to do here… Recall that trim.seqs only looks for hte barcodes / primers at the very beginning of the sequnece.

Pat

---

<div class="post-metadata">

**Author:** ![jenz](https://avatars.discourse-cdn.com/v4/letter/j/4bbf92/32.png) [@jenz](https://forum.mothur.org/u/jenz)\
**Post date:** [April 20, 2013, 12:07pm UTC](https://forum.mothur.org/t/trim-seqs-oligos/1314/3 "2013-04-20T12:07:06Z")

</div>

OK in this case I’ll have to do some Perl myself I guess. I was hoping to use these features of mothur to get rid of those suspect sequences/remove those oligos from sequences.  
Shouldn’t the trim file be just full and scrap wholly empty when there are no such oligos in the beginning of sequences. The current situation of scrap wholly full and trim wholly empty seems to suggest that the trim.seqs command finds every sequence to contain this oligo ?

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [April 21, 2013, 2:05pm UTC](https://forum.mothur.org/t/trim-seqs-oligos/1314/4 "2013-04-21T14:05:27Z")

</div>

No, if trim.seqs can’t find the barcode and the primer then it goes to scrap since we assume everything will have a barcode/primer. The “|b” means that it got scrapped because a barcode couldn’t be found.
