# Run QIIME2 test data with Mothur
**URL:** https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654
**Category:** Commands in mothur
**Created:** [December 18, 2018, 5:03pm UTC](https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654 "2018-12-18T17:03:43Z")
**Posts on this page:** 4
**Page:** 1
### Author:  [@Bioinfo\_RB](https://forum.mothur.org/u/Bioinfo_RB)
#### Post date: [December 18, 2018, 5:03pm UTC](https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654/1 "2018-12-18T17:03:44Z")
Hello,
I am trying to run QIIME2 qiime2-moving-pictures-tutorial with mothur pipeline. This data is single end fastq format for V4 region sequenced with HiSeq platfom.
I first ran
`fastq.info(fastq=sequences.fastq)`
followed by
`trim.seqs(fasta=sequences.fasta,qual=sequences.qual,oligos=sample.oligos)`
After this command I am getting empty trim, group and qual files
This is the link for metadata file from qiime2-moving-pictures-tutorial
[https://data.qiime2.org/2018.11/tutorials/moving-pictures/sample\_metadata.tsv](https://data.qiime2.org/2018.11/tutorials/moving-pictures/sample_metadata.tsv)
And my oligo file looks like
| forward | GTGCCAGCMGCCGCGGTAA | |
| --- | --- | --- |
| #reverse | GTGCCAGCMGCCGCGGTAA | |
| barcode | AGCTGACTAGTC | L1S8 |
| barcode | ACACACTATGGC | L1S57 |
| barcode | ACTACGTGTGGT | L1S76 |
| barcode | AGTGCGATGCGT | L1S105 |
| barcode | ACGATGCGACCA | L2S155 |
| barcode | AGCTATCCACGA | L2S175 |
| barcode | ATGCAGCTCAGT | L2S204 |
| barcode | CACGTGACATGT | L2S222 |
| barcode | ACAGTTGCGCGA | L3S242 |
| barcode | CACGACAGGCTA | L3S294 |
| barcode | AGTGTCACGGTG | L3S313 |
| barcode | CAAGTGAGAGAG | L3S341 |
| barcode | CATCGTATCAAC | L3S360 |
| barcode | CAGTGTCAGGAC | L5S104 |
| barcode | ATCTTAGACTGC | L5S155 |
| barcode | CAGACATTGCGT | L5S174 |
| barcode | CGATGCACCAGA | L5S203 |
| barcode | CTAGAGACTCTT | L5S222 |
| barcode | ATGGCAGCTCTA | L1S140 |
| barcode | CTGAGATACGCG | L1S208 |
| barcode | CCGACTGAGATG | L1S257 |
| barcode | CCTCTCGTGATC | L1S281 |
| barcode | CATATCGCAGTT | L2S240 |
| barcode | CGTGCATTATCA | L2S309 |
| barcode | CTAACGCAGTCA | L2S357 |
| barcode | CTCAATGACTCA | L2S382 |
| barcode | ATCGATCTGTGG | L3S378 |
| barcode | CTCGTGGAGTAG | L4S63 |
| barcode | GCGTTACACACA | L4S112 |
| barcode | GAACTGTATCTC | L4S137 |
| barcode | CTGGACTCATAG | L5S240 |
| barcode | GAGGCTCATCAT | L6S20 |
| barcode | GATACGTCCTGA | L6S68 |
| barcode | GATTAGCACTCT | L6S93 |
Can you help me to figure out what is wrong with this oligo file.
Thank you
---
### Author:  [@pschloss](https://forum.mothur.org/u/pschloss)
#### Post date: [December 20, 2018, 4:41pm UTC](https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654/2 "2018-12-20T16:41:25Z")
Ugh, single read HiSeq data. About the only thing worse is IonTorrent data 🙂
You need to look at the sequences and see if they start with the barcode sequences that you have. trim.seqs will first look for the barcode sequences and then the primer. It needs to be in that order with nothing in between.
Also, once you run it through trim.seqs, you can look at the content of the scrap.fasta file and see what the letters are after the `|` character in the line that starts with `>`. If it is a `b`, that means it was a barcode issue, if it is a `f`, that means it couldn’t find the forward primer.
---
### Author:  [@Bioinfo\_RB](https://forum.mothur.org/u/Bioinfo_RB)
#### Post date: [December 20, 2018, 5:03pm UTC](https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654/3 "2018-12-20T17:03:32Z")
Hi Pat,
Thank you for the reply.
Before making the oligo file I have tried to grep the barcodes and primers but unfortunately I am not able to grep them.
And I am not understanding how these samples can be multplixed.
This is the header of my file looks like this:
`
> HWI-EAS440\_0386\_1\_23\_17547\_1423#0/1|b(b) fbdiffs=1000(noMatch), rbdiffs=1000(noMatch)
> TACGNAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGGGGGGATTGGTGTG`
I also tried Flip=T for reversecomplement but still the all the data goes to scrap file.
And sorry to bother during holiday time 😥
Thank you in advance
---
### Author:  [@pschloss](https://forum.mothur.org/u/pschloss)
#### Post date: [January 8, 2019, 5:03pm UTC](https://forum.mothur.org/t/run-qiime2-test-data-with-mothur/19654/5 "2019-01-08T17:03:58Z")
I don’t think you’d get the index sequence since I think they generated those with a separate sequence read that is used to multiplex the samples. At least for the sequence you’ve posted, they don’t seem to have the primer. Perhaps that was removed too before they posted the sequence data? Is it possible to get the raw fastq files?
Pat