# Problem of trim.flows command **URL:** \ **Category:** Commands in mothur\ **Created:** [July 16, 2012, 3:58pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975 "2012-07-16T15:58:46Z")\ **Posts on this page:** 15\ **Page:** 1
**Author:** ![jxc](https://avatars.discourse-cdn.com/v4/letter/j/b5ac83/32.png) [@jxc](https://forum.mothur.org/u/jxc)\ **Post date:** [July 16, 2012, 3:58pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/1 "2012-07-16T15:58:46Z")
Hi, I have a problem when I tried to run trim.flows command: my .flow file is 1.19 GB, and the .scrap.flow file generated from this step is about 900 GB, and it is still increasing, and this command is still running. I am not sure if this is normal? I am worried that if this file size continuously goes up, the hard drive of my computer will not be enough, and I will not be able to finish this step. The command I used: mothur \> trim.flows(flow=seq.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8) The oligos file I used: Forward ACTCCTACGGGAGGCAGCAG #Reverse CCGTCAATTCMTTTRAGT barcode TTGGCGTA L1-6 barcode TGCTGTTC L1-12 barcode TGAGGTGA L1-18 … Anyone have any idea about this? Thank you in advance! ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [July 20, 2012, 12:11pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/2 "2012-07-20T12:11:10Z")
can you tell us what the first line of seq.flow has on it? ---
**Author:** ![jxc](https://avatars.discourse-cdn.com/v4/letter/j/b5ac83/32.png) [@jxc](https://forum.mothur.org/u/jxc)\ **Post date:** [July 20, 2012, 2:31pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/3 "2012-07-20T14:31:12Z")
Thank you for your reply! This is the first and second line of seq.flow: 800 HPM5JEW01BLYM2 144 1.11 0.00 0.97 0.00 0.00 0.96 0.12 0.58 1.66 0.31 1.11 1.16 0.56 1.76 0.34 1.17 0.03 0.71 0.90 0.35 0.01 0.94 … ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [July 20, 2012, 6:43pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/4 "2012-07-20T18:43:27Z")
Sorry - can you post the entire second line? also, are you sure about your file sizes being GB and not MB? ---
**Author:** ![jxc](https://avatars.discourse-cdn.com/v4/letter/j/b5ac83/32.png) [@jxc](https://forum.mothur.org/u/jxc)\ **Post date:** [July 20, 2012, 7:57pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/5 "2012-07-20T19:57:40Z")
Thank you for your reply! I checked the size of my files again, and I am sure they are GB, not MB. This make me feel very confused. Yesterday I found that the seq.scrap.flow file is over 900 GB, and there is no space in my D drive anymore, but mothur was still running. I removed about 15 MB files (that’s all I could remove from D drive) yesterday to give it more space to keep on running, but I found that the size of that seq.scrap.flow file didn’t increase after that. Now mothur is still running, but it is giving out negative numbers. For example, when the command trim.flows started it was like this: mothur \> trim.flows(flow=seq.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8) 10000 20000 … Now it is like: -2431420000 -2431410000 -2431400000 … I am not sure if this is normal? ----------------------------------------------------------The first several lines of seq.flow file are showed below---------------------------------------------------------------- 800 HPM5JEW01BLYM2 144 1.11 0.00 0.97 0.00 0.00 0.96 0.12 0.58 1.66 0.31 1.11 1.16 0.56 1.76 0.34 1.17 0.03 0.71 0.90 0.35 0.01 0.94 1.00 0.00 0.70 0.20 1.01 0.01 0.43 0.48 1.04 1.03 0.30 0.81 1.03 0.98 0.33 0.58 0.96 1.07 0.16 0.88 0.57 1.11 0.14 0.47 1.09 0.91 0.00 1.22 0.69 1.00 0.01 0.65 1.08 0.80 0.04 1.07 1.14 0.61 0.00 1.12 1.09 0.43 0.00 1.12 0.82 1.27 0.03 1.21 0.42 1.17 0.27 1.12 0.29 1.13 0.23 0.99 0.11 1.06 0.26 0.68 0.11 0.89 0.29 0.70 0.21 0.90 0.20 0.72 0.29 0.73 0.15 0.53 0.25 0.58 0.10 0.50 0.23 0.65 0.15 0.39 0.25 0.50 0.17 0.33 0.42 0.61 0.08 0.56 0.35 0.46 0.12 0.40 0.32 0.42 0.06 0.41 0.49 0.29 0.07 0.56 0.62 0.32 0.02 0.84 0.44 0.90 0.04 0.85 0.39 0.80 0.19 0.78 0.33 0.76 0.16 0.68 0.27 0.80 0.16 0.65 0.08 0.70 0.13 0.49 0.18 0.51 0.12 0.46 0.22 0.38 0.12 0.28 0.12 0.31 0.14 0.30 0.09 0.39 0.12 0.22 0.11 0.24 0.12 0.22 0.14 0.29 0.13 0.30 0.11 0.20 0.15 0.22 0.12 0.18 0.13 0.17 0.16 0.15 0.11 0.20 0.17 0.13 0.12 0.22 0.13 0.19 0.11 0.24 0.10 0.21 0.11 0.26 0.12 0.19 0.08 0.25 0.07 0.20 0.08 0.18 0.02 0.20 0.08 0.12 0.05 0.19 0.06 0.14 0.07 0.19 0.06 0.15 0.08 0.17 0.06 0.13 0.05 0.17 0.06 0.13 0.05 0.16 0.07 0.14 0.08 0.15 0.06 0.14 0.07 0.13 0.05 0.15 0.06 0.12 0.04 0.15 0.08 0.11 0.05 0.16 0.08 0.09 0.04 0.17 0.08 0.13 0.05 0.11 0.07 0.13 0.04 0.11 0.06 0.10 0.03 0.13 0.08 0.09 0.05 0.09 0.06 0.10 0.02 0.07 0.07 0.11 0.02 0.08 0.10 0.10 0.00 0.06 0.08 0.08 0.01 0.07 0.08 0.07 0.01 0.07 0.08 0.08 0.02 0.04 0.10 0.12 0.02 0.06 0.08 0.12 0.02 0.05 0.06 0.09 0.02 0.08 0.06 0.10 0.03 0.07 0.05 0.11 0.03 0.08 0.05 0.12 0.02 0.07 0.05 0.11 0.05 0.08 0.03 0.10 0.10 0.08 0.03 0.10 0.08 0.09 0.01 0.13 0.07 0.08 0.03 0.10 0.08 0.11 0.01 0.10 0.08 0.07 0.02 0.10 0.09 0.08 0.00 0.12 0.08 0.11 0.01 0.11 0.07 0.06 0.02 0.11 0.06 0.05 0.01 0.13 0.07 0.03 0.02 0.14 0.05 0.02 0.03 0.14 0.07 0.06 0.03 0.11 0.07 0.04 0.04 0.12 0.06 0.07 0.03 0.11 0.05 0.04 0.01 0.09 0.05 0.04 0.02 0.09 0.04 0.03 0.02 0.10 0.03 0.06 0.02 0.10 0.03 0.08 0.04 0.09 0.04 0.04 0.05 0.08 0.04 0.06 0.04 0.08 0.04 0.06 0.05 0.07 0.04 0.05 0.06 0.07 0.04 0.05 0.03 0.07 0.04 0.05 0.05 0.06 0.04 0.06 0.03 0.06 0.06 0.05 0.03 0.07 0.06 0.05 0.03 0.06 0.06 0.04 0.04 0.07 0.05 0.04 0.04 0.07 0.06 0.04 0.04 0.07 0.07 0.04 0.04 0.06 0.06 0.04 0.04 0.06 0.05 0.02 0.01 0.08 0.06 0.03 0.02 0.08 0.06 0.01 0.02 0.08 0.07 0.01 0.00 0.07 0.05 0.02 0.00 0.10 0.04 0.05 0.00 0.09 0.05 0.05 0.00 0.11 0.04 0.04 0.00 0.10 0.04 0.03 0.00 0.10 0.05 0.03 0.00 0.12 0.06 0.03 0.00 0.12 0.05 0.04 0.00 0.10 0.06 0.01 0.00 0.10 0.07 0.04 0.00 0.09 0.06 0.02 0.00 0.10 0.06 0.03 0.00 0.09 0.05 0.04 0.00 0.09 0.04 0.02 0.00 0.10 0.04 0.05 0.00 0.08 0.04 0.05 0.00 0.07 0.04 0.05 0.00 0.07 0.05 0.02 0.00 0.07 0.05 0.03 0.00 0.07 0.05 0.04 0.00 0.06 0.04 0.07 0.00 0.07 0.04 0.07 0.00 0.07 0.04 0.07 0.00 0.07 0.03 0.07 0.00 0.06 0.02 0.06 0.00 0.06 0.02 0.07 0.00 0.07 0.02 0.07 0.00 0.07 0.02 0.04 0.00 0.08 0.02 0.03 0.02 0.09 0.01 0.04 0.02 0.07 0.02 0.03 0.03 0.08 0.01 0.02 0.07 0.07 0.02 0.04 0.05 0.06 0.03 0.01 0.05 0.05 0.02 0.02 0.05 0.05 0.01 0.01 0.05 0.03 0.02 0.03 0.04 0.04 0.02 0.01 0.05 0.03 0.02 0.02 0.06 0.04 0.02 0.00 0.05 0.04 0.01 0.00 0.05 0.03 0.01 0.00 0.05 0.02 0.01 0.01 0.03 0.05 0.01 0.01 0.03 0.06 0.01 0.01 0.03 0.07 0.01 0.02 0.02 0.07 0.01 0.02 0.01 0.08 0.02 0.03 0.01 0.06 0.01 0.04 0.02 0.06 0.01 0.06 0.01 0.06 0.01 0.06 0.02 0.06 0.02 0.07 0.01 0.06 0.02 0.05 0.00 0.07 0.04 0.05 0.02 0.06 0.03 0.04 0.03 0.07 0.03 0.04 0.03 0.07 0.04 0.04 0.04 0.05 0.04 0.04 0.06 0.05 0.03 0.06 0.05 0.04 0.02 0.05 0.06 0.03 0.02 0.07 0.06 0.03 0.03 0.08 0.06 0.03 0.05 0.06 0.05 0.02 0.04 0.05 0.04 0.03 0.07 0.03 0.03 0.04 0.05 0.05 0.04 0.03 0.07 0.04 0.02 0.05 0.07 0.06 0.02 0.05 0.08 0.03 0.01 0.05 0.10 0.02 0.01 0.04 0.08 0.02 0.01 0.03 0.08 0.03 0.01 0.04 0.08 0.02 0.02 0.04 0.06 0.03 0.00 0.03 0.08 0.04 0.00 0.06 0.05 0.04 0.01 0.05 0.06 0.05 0.01 0.06 0.05 0.02 0.02 0.05 0.05 0.03 0.02 0.05 0.06 0.05 0.01 0.05 0.05 0.05 0.02 0.07 0.04 0.04 0.02 0.05 0.06 0.04 0.02 0.06 0.05 0.02 0.03 0.08 HPM5JEW01CGYCQ 136 1.12 0.00 0.89 0.00 0.00 1.00 0.17 0.62 0.61 1.21 0.34 1.39 0.87 1.10 0.88 0.44 1.22 0.94 0.59 0.91 0.47 1.23 1.05 0.70 0.62 0.87 0.98 0.00 0.48 0.34 1.01 1.07 0.25 0.56 1.07 1.03 0.41 0.56 1.03 1.09 0.14 0.89 0.81 1.20 0.26 0.59 1.10 1.16 0.06 0.88 0.97 0.99 0.34 0.68 1.16 1.01 0.18 1.12 1.00 0.69 0.46 0.81 0.86 0.85 0.29 1.38 0.51 1.05 0.90 1.14 0.44 1.00 0.78 1.10 0.47 1.02 0.67 0.99 0.43 1.02 0.61 0.93 0.33 0.96 0.51 0.98 0.34 0.97 0.47 0.83 0.37 0.94 0.41 0.76 0.52 0.81 0.38 0.70 0.69 0.91 0.23 0.79 0.76 0.85 0.19 0.74 0.81 0.72 0.12 0.82 0.95 0.62 0.06 0.96 0.96 0.88 0.03 1.06 0.83 0.98 0.10 1.13 0.65 1.12 0.15 1.10 0.53 1.12 0.15 0.89 0.42 1.03 0.11 0.70 0.29 0.88 0.12 0.49 0.18 0.75 0.07 0.47 0.10 0.63 0.07 0.37 0.10 0.46 0.06 0.29 0.10 0.37 0.08 0.18 0.08 0.31 0.07 0.19 0.11 0.28 0.14 0.19 0.11 0.28 0.18 0.20 0.13 0.27 0.20 0.28 0.13 0.24 0.22 0.23 0.17 0.21 0.24 0.24 0.16 0.20 0.25 0.29 0.12 0.23 0.20 0.30 0.14 0.21 0.23 0.28 0.12 0.20 0.15 0.34 0.09 0.19 0.12 0.35 0.09 0.18 0.14 0.30 0.10 0.20 0.11 0.24 0.09 0.18 0.09 0.27 0.09 0.18 0.10 0.24 0.10 0.19 0.11 0.20 0.09 0.16 0.11 0.18 0.10 0.18 0.12 0.21 0.09 0.19 0.10 0.18 0.10 0.17 0.10 0.17 0.11 0.17 0.07 0.20 0.10 0.15 0.10 0.16 0.10 0.13 0.05 0.14 0.10 0.13 0.05 0.17 0.12 0.12 0.04 0.18 0.11 0.12 0.03 0.16 0.12 0.09 0.03 0.13 0.12 0.11 0.00 0.11 0.11 0.10 0.00 0.09 0.14 0.12 0.00 0.08 0.12 0.10 0.00 0.08 0.12 0.08 0.00 0.04 0.12 0.10 0.00 0.06 0.11 0.09 0.00 0.08 0.11 0.10 0.00 0.08 0.09 0.11 0.00 0.08 0.06 0.12 0.00 0.04 0.09 0.13 0.00 0.05 0.06 0.17 0.01 0.06 0.03 0.16 0.02 0.06 0.03 0.14 0.02 0.06 0.00 0.13 0.05 0.08 0.00 0.12 0.07 0.06 0.00 0.10 0.07 0.08 0.00 0.10 0.07 0.08 0.00 0.10 0.07 0.06 0.00 0.07 0.10 0.08 0.00 0.09 0.07 0.05 0.00 0.08 0.07 0.04 0.00 0.10 0.06 0.04 0.00 0.11 0.07 0.04 0.00 0.06 0.07 0.04 0.00 0.08 0.07 0.03 0.00 0.10 0.08 0.02 0.00 0.10 0.07 0.02 0.00 0.10 0.08 0.01 0.00 0.10 0.07 0.02 0.00 0.10 0.07 0.01 0.00 0.10 0.08 0.02 0.00 0.08 0.08 0.02 0.00 0.08 0.07 0.01 0.00 0.05 0.06 0.01 0.00 0.04 0.06 0.00 0.02 0.05 0.03 0.01 0.00 0.02 0.02 0.01 0.01 0.01 0.02 0.01 0.03 0.03 0.02 0.01 0.02 0.02 0.03 0.00 0.04 0.01 0.04 0.00 0.03 0.00 0.02 0.00 0.01 0.00 0.04 0.00 0.00 0.02 0.02 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.04 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.01 0.01 0.00 0.00 0.00 0.02 0.00 0.00 0.01 0.00 0.00 0.00 0.03 0.01 0.03 0.00 0.05 0.02 0.00 0.00 0.04 0.01 0.00 0.00 0.02 0.04 0.00 0.00 0.04 0.02 0.00 0.00 0.05 0.01 0.00 0.00 0.05 0.00 0.00 0.00 0.06 0.00 0.00 0.00 0.06 0.01 0.00 0.00 0.06 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 HPM5JEW01DPMV7 97 1.03 0.07 0.99 0.08 0.03 1.04 0.04 0.84 1.78 0.13 0.03 1.39 0.19 0.08 0.87 1.09 0.84 1.61 1.09 0.34 1.02 0.47 1.28 0.10 0.53 0.59 1.03 1.24 0.34 1.21 0.62 0.89 0.28 0.66 1.06 0.54 0.11 1.15 0.30 0.76 0.05 0.29 0.87 0.26 0.04 0.92 0.28 0.66 0.58 0.27 0.30 1.12 0.21 0.25 0.94 0.42 0.20 0.73 0.29 1.11 0.09 0.20 0.98 0.85 0.13 0.18 0.96 0.96 0.06 0.86 0.22 0.18 1.31 0.05 0.94 1.11 0.26 1.86 0.22 0.85 0.16 1.00 0.19 0.36 0.62 1.16 0.92 0.24 0.73 0.37 0.73 0.21 0.16 1.95 0.22 0.14 0.77 0.42 0.23 0.68 0.18 1.56 0.16 0.23 1.30 0.31 0.10 0.73 0.29 0.85 0.82 1.23 0.18 0.32 0.78 0.20 0.81 0.16 0.24 0.69 0.14 0.71 0.25 0.81 0.19 0.93 0.99 0.25 1.00 0.27 0.20 0.78 0.15 0.20 1.66 0.25 0.15 2.94 0.23 1.34 0.15 0.23 0.43 0.38 0.08 0.63 0.86 0.08 0.04 1.03 1.06 0.21 0.07 0.70 0.36 1.99 0.10 0.95 0.23 0.63 0.62 0.65 0.14 0.73 0.19 0.48 0.11 0.91 0.14 0.18 0.13 0.43 0.15 0.39 0.18 0.05 0.15 0.29 0.13 0.33 0.08 0.10 0.11 0.23 0.07 0.22 0.08 0.29 0.11 0.21 0.07 0.19 0.11 0.18 0.05 0.22 0.07 0.12 0.06 0.13 0.06 0.13 0.05 0.13 0.04 0.10 0.05 0.10 0.05 0.11 0.05 0.09 0.05 0.11 0.07 0.09 0.05 0.09 0.07 0.09 0.06 0.10 0.07 0.11 0.06 0.09 0.07 0.10 0.05 0.08 0.06 0.10 0.06 0.08 0.06 0.10 0.05 0.09 0.06 0.11 0.07 0.10 0.08 0.09 0.06 0.11 0.09 0.09 0.05 0.11 0.07 0.09 0.05 0.10 0.07 0.09 0.03 0.11 0.07 0.09 0.04 0.10 0.09 0.09 0.05 0.10 0.09 0.10 0.05 0.10 0.08 0.09 0.04 0.10 0.08 0.09 0.05 0.10 0.09 0.09 0.05 0.09 0.08 0.10 0.04 0.08 0.08 0.10 0.04 0.09 0.08 0.09 0.04 0.09 0.07 0.09 0.04 0.10 0.07 0.09 0.03 0.09 0.07 0.10 0.03 0.09 0.08 0.11 0.04 0.11 0.06 0.11 0.05 0.12 0.06 0.12 0.04 0.12 0.06 0.13 0.05 0.10 0.05 0.13 0.05 0.09 0.06 0.11 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.09 0.06 0.10 0.05 0.09 0.07 0.11 0.06 0.10 0.05 0.11 0.06 0.09 0.05 0.11 0.05 0.11 0.06 0.10 0.06 0.12 0.05 0.11 0.07 0.12 0.05 0.13 0.07 0.10 0.06 0.10 0.07 0.11 0.04 0.11 0.08 0.09 0.04 0.09 0.07 0.10 0.04 0.10 0.09 0.10 0.04 0.09 0.06 0.10 0.04 0.09 0.07 0.12 0.05 0.08 0.06 0.12 0.05 0.09 0.06 0.12 0.05 0.11 0.05 0.10 0.05 0.10 0.05 0.09 0.05 0.10 0.06 0.09 0.05 0.10 0.05 0.09 0.05 0.09 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.11 0.05 0.10 0.04 0.10 0.08 0.11 0.04 0.09 0.09 0.10 0.04 0.09 0.08 0.09 0.04 0.10 0.09 0.09 0.05 0.10 0.08 0.10 0.05 0.10 0.07 0.10 0.05 0.10 0.07 0.09 0.05 0.09 0.07 0.09 0.06 0.09 0.07 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.09 0.06 0.11 0.06 0.09 0.06 0.10 0.06 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.08 0.06 0.10 0.05 0.08 0.05 0.11 0.05 0.09 0.06 0.11 0.05 0.09 0.07 0.08 0.05 0.09 0.07 0.09 0.05 0.10 0.06 0.10 0.04 0.13 0.06 0.11 0.04 0.12 0.06 0.12 0.04 0.11 0.06 0.11 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.05 0.10 0.05 0.11 0.06 0.10 0.05 0.11 0.05 0.11 0.04 0.10 0.05 0.10 0.04 0.10 0.05 0.10 0.05 0.10 0.05 0.10 0.05 0.09 0.05 0.11 0.05 0.09 0.04 0.11 0.05 0.09 0.04 0.11 0.05 0.09 0.05 0.10 0.04 0.10 0.04 0.10 0.04 0.11 0.04 0.11 0.05 0.10 0.05 0.12 0.06 0.10 0.05 0.10 0.06 0.11 0.05 0.09 0.07 0.12 0.04 0.10 0.06 0.11 0.04 0.10 0.07 0.11 0.04 0.09 0.08 0.11 0.04 0.09 0.09 0.11 0.04 0.10 0.08 0.09 0.04 0.12 0.07 0.09 0.03 0.11 0.07 0.09 0.04 0.10 0.07 0.09 0.04 0.10 0.06 0.09 0.04 0.10 0.06 0.09 0.04 0.09 0.06 0.08 0.04 0.09 0.06 0.09 0.04 0.10 0.05 0.10 0.04 0.10 0.05 0.09 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.10 0.04 0.10 0.05 0.11 0.04 0.10 0.05 0.10 0.04 0.11 0.05 0.10 0.03 0.12 0.06 0.09 0.03 0.12 0.05 0.09 0.05 0.13 0.04 0.10 0.04 0.11 0.06 0.09 0.04 0.11 0.05 0.08 0.05 0.11 0.06 0.08 0.05 0.11 0.06 0.10 0.05 0.11 0.06 0.10 0.05 0.10 0.07 0.08 0.05 0.10 0.07 0.09 0.04 0.10 0.08 0.09 0.05 0.11 0.08 0.09 0.04 0.12 0.06 0.08 0.05 0.11 0.06 0.09 0.05 0.10 0.06 0.08 0.05 0.10 0.06 0.08 0.06 0.10 0.06 0.09 0.06 0.10 0.06 0.09 0.05 0.09 0.05 0.08 0.06 0.08 0.05 0.09 0.05 0.08 0.05 0.09 0.05 0.08 0.05 0.09 0.05 0.09 0.06 0.08 0.05 0.09 0.05 0.08 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.09 0.04 0.09 0.05 0.10 0.05 0.09 0.06 0.09 0.05 0.08 0.06 0.09 0.04 0.10 0.06 0.09 0.04 0.09 0.06 0.09 0.05 0.10 0.06 0.09 0.04 0.10 0.08 0.10 HPM5JEW01DXV8S 140 1.10 0.00 1.00 0.00 0.00 0.95 0.10 0.58 1.00 0.59 1.18 0.40 0.11 1.20 1.25 0.89 0.00 1.18 1.17 0.09 0.03 1.66 1.07 0.00 0.51 0.37 1.02 0.19 0.32 0.52 1.04 1.10 0.23 0.77 1.02 1.02 0.19 0.62 0.84 1.11 0.08 0.84 0.56 1.11 0.02 0.51 0.74 0.88 0.04 0.81 0.45 1.23 0.00 0.80 0.15 1.23 0.30 0.58 0.25 1.13 0.24 0.71 0.51 1.14 0.11 0.98 0.30 1.16 0.16 1.17 0.18 1.14 0.45 0.97 0.25 1.03 0.40 1.01 0.46 1.10 0.25 0.93 0.51 1.03 0.39 0.50 0.40 0.96 0.36 0.72 0.35 1.07 0.19 1.00 0.50 0.83 0.33 0.57 0.47 0.72 0.25 0.61 0.76 0.78 0.17 0.98 0.77 0.87 0.19 0.80 0.75 0.92 0.08 0.71 0.97 0.51 0.06 0.94 1.01 0.46 0.05 1.10 0.76 1.08 0.07 1.03 0.43 1.06 0.15 1.18 0.33 1.05 0.14 0.89 0.22 1.04 0.08 0.52 0.20 0.86 0.09 0.46 0.23 0.56 0.13 0.39 0.20 0.49 0.08 0.36 0.14 0.34 0.06 0.28 0.13 0.35 0.06 0.27 0.14 0.26 0.14 0.19 0.11 0.33 0.13 0.20 0.13 0.24 0.12 0.20 0.11 0.31 0.08 0.24 0.05 0.33 0.06 0.32 0.06 0.32 0.06 0.29 0.05 0.30 0.06 0.16 0.03 0.19 0.09 0.10 0.10 0.15 0.12 0.15 0.07 0.11 0.08 0.18 0.08 0.11 0.05 0.14 0.04 0.10 … ---
**Author:** ![westcott](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/westcott/32/18_2.png) [@westcott](https://forum.mothur.org/u/westcott)\ **Post date:** [July 30, 2012, 5:32pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/6 "2012-07-30T17:32:19Z")
It seems like mothur is reading beyond the end of the file. Was the flow file created by mothur? Could you try a few things to help me narrow it down? Let’s try grabbing the end of the file: //let’s grab the last 100 flows: imac:debug SarahsWork$ tail -100 seq.flow \> seqEnd.flow Then open seqEnd.flow and add 800 as the first line. Now try running trim.flows(flow=seqEnd.flow, oligos=lysim.oligos, pdiffs=2, bdiffs=1, maxhomop=8). If that still fails, could you send the seqEnd.flow file to [mothur.bugs@gmail.com](mailto:mothur.bugs@gmail.com)? ---
**Author:** ![jxc](https://avatars.discourse-cdn.com/v4/letter/j/b5ac83/32.png) [@jxc](https://forum.mothur.org/u/jxc)\ **Post date:** [August 1, 2012, 3:40pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/7 "2012-08-01T15:40:25Z")
Thank you very much for your reply! Sorry for replying late, I was not able to check this earlier. For your question "Was the flow file created by mothur? ": Yes, I used sffinfo to generate .fasta, .qual and .flow files for the two halves (I named them seq1 and seq2), and then merged them together and named it “seq”. I tried to follow your suggestion, but cannot run the very first step you suggested. So I hope to know more details about it: I am confused by the “imac:debug SarahsWork$ tail -100 seq.flow \> seqEnd.flow”. Is this syntax to be input into mothur? In addition, I am using windows, I am not sure if there is anything I should change… Thank you in advance! ---
**Author:** ![westcott](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/westcott/32/18_2.png) [@westcott](https://forum.mothur.org/u/westcott)\ **Post date:** [August 1, 2012, 3:58pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/8 "2012-08-01T15:58:47Z")
Sorry, the tail command is not available on Windows. How did you merge the files? merge.files command? ---
**Author:** ![jxc](https://avatars.discourse-cdn.com/v4/letter/j/b5ac83/32.png) [@jxc](https://forum.mothur.org/u/jxc)\ **Post date:** [August 1, 2012, 5:46pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/9 "2012-08-01T17:46:13Z")
> [@westcott](#): > > Sorry, the tail command is not available on Windows. How did you merge the files? merge.files command? Yes, I used merge.files command to merge the seq1.flow & seq2.flow, seq1.fasta & seq2.fasta, seq1.qual & seq2.qual together and generated seq.flow, seq.fasta and seq.qual files. ---
**Author:** ![westcott](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/westcott/32/18_2.png) [@westcott](https://forum.mothur.org/u/westcott)\ **Post date:** [August 3, 2012, 3:29pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/10 "2012-08-03T15:29:07Z")
You can’t use merge.files to combine the 2 flow files, because the number of flows in included twice. For example: 800 HPM5JEW02ICN5B 783 0.98 0.01 0.98 0.09 0.00 1.06 0.05 0.82 1.14 0.02 1.18 0.09 0.05 0.98 0.05 … HPM5JEW02FQKQP 772 1.05 0.02 0.96 0.02 0.00 1.02 0.06 1.07 1.03 1.43 0.90 2.12 0.15 0.32 0.85 … HPM5JEW02FWYMT 564 0.98 0.00 1.01 0.00 0.00 1.04 0.00 1.58 0.14 0.00 1.09 0.17 0.06 0.89 0.12 … … 800 HPM5JEW02ICN5B 783 0.98 0.01 0.98 0.09 0.00 1.06 0.05 0.82 1.14 0.02 1.18 0.09 0.05 0.98 0.05 … HPM5JEW02FQKQP 772 1.05 0.02 0.96 0.02 0.00 1.02 0.06 1.07 1.03 1.43 0.90 2.12 0.15 0.32 0.85 … HPM5JEW02FWYMT 564 0.98 0.00 1.01 0.00 0.00 1.04 0.00 1.58 0.14 0.00 1.09 0.17 0.06 0.89 0.12 … … The trim.flows command reads the second 800 as a flow and does not know how to process it. I would recommend running trim.flows, shhh.flows and trim.seqs on the each set of files separately and then merging. I hope this helps. -Sarah ---
**Author:** ![arifch](https://avatars.discourse-cdn.com/v4/letter/a/8797f3/32.png) [@arifch](https://forum.mothur.org/u/arifch)\ **Post date:** [January 22, 2013, 7:40am UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/11 "2013-01-22T07:40:21Z")
Hi, I am using mothur v.1.25.1. I have a few trouble with trim.flow command. 1. I specified minflows=75, maxflows=default and majority of my data went to scrap file. When I looked at the seqs that went to the scrap, a lot of them has length \>100bp but the flow no. are low (\<100). Are all these seqs actually not good to use for downstream analysis? below is an example of one accession no. from scrap.flow and the same accession no. that shows sequence and quality from .sff file H2SYBJJ03HJRH8|lb 20 1.00 0.00 1.02 0.02 0.00 1.05 0.02 1.06 0.01 1.38 2.10 1.10 0.03 0.04 1.00 0.07 0.00 0.76 0.03 0.00 0.68 0.01 0.00 1.07 0.01 2.05 0.08 0.00 1.92 0.10 0.00 1.05 0.03 0.04 1.06 0.04 0.02 0.99 0.07 1.09 0.04 1.75 1.08 0.08 1.15 0.11 1.96 1.04 1.04 0.05 0.05 0.96 0.07 1.88 1.85 0.12 0.00 1.97 0.11 0.01 1.05 0.06 0.04 2.05 0.09 0.00 1.96 0.12 0.98 0.04 0.98 0.04 1.90 0.02 0.06 0.98 0.10 1.60 1.05 1.00 > H2SYBJJ03HJRH8 length=309 xy=2978\_1646 region=3 run=R\_2013\_01\_13\_06\_43\_57\_ > ACCGCATGAATTGCAGAACTCCGTGAACCAATGGCCTCTTGAACGTGCATTGCGCTCTTG > GGATATGCCTGAGAGCATGTCTGCTTCAGTGCTTCTACTTTCATTTTCTGCTGCTCTTGT > TATCAGGAGCAGTGTTGCTGCATGCTTCTGCAAGTGGCACTGGCATGCTAAATATCAAGT > TTTGCTTGCTGTTGTGACTGATCAACATCTCATGTCGTTTCAGTTGGCGAAACAAAAGCT > CATGTGTGTTCTTAACACCTCCTAGCATGAAGTCAGACAAGTGAACCCGCTGAACTTAAG > CATATGGAT > H2SYBJJ03HJRH8 length=309 xy=2978\_1646 region=3 run=R\_2013\_01\_13\_06\_43\_57\_ > 26 26 26 40 40 40 40 40 40 40 40 40 40 40 40 40 34 34 38 39 40 40 40 40 40 39 39 39 39 40 40 40 40 40 40 40 40 40 40 40 30 26 26 26 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 > 39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 30 30 40 40 34 34 34 34 40 40 40 40 40 40 40 40 40 40 40 40 40 > 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 35 34 30 30 30 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 30 30 40 40 40 39 39 39 39 32 > 33 34 34 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 30 30 30 39 40 30 30 30 39 39 40 40 39 38 38 39 32 32 32 32 40 40 40 > 40 40 40 40 39 39 39 39 40 40 40 40 40 40 40 40 30 30 30 30 30 39 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 39 39 39 40 40 40 40 30 30 30 40 40 40 40 40 > 40 40 40 40 40 40 40 40 30 1. When I looked at the .trim.flow file from the result of the same command above, I found at least 1 seq that has usable flow no. of 108 but has length of 57bp. Why did this seq pass? H2SYBJJ03HJHH2 108 1.00 0.00 0.98 0.00 0.00 1.08 0.00 1.10 0.00 1.04 1.89 0.08 0.00 1.81 1.74 0.96 0.07 0.94 0.19 0.07 1.1 > H2SYBJJ03HJHH2 length=57 xy=2975\_0968 region=3 run=R\_2013\_01\_13\_06\_43\_57\_ > ACCAACCGATGCAGACTCCGTGACCATGGCTCTTGACGTGCATTGCGCTCTTGGGAG > H2SYBJJ03HJHH2 length=57 xy=2975\_0968 region=3 run=R\_2013\_01\_13\_06\_43\_57\_ > 37 37 37 25 25 23 23 34 35 35 35 35 32 32 32 32 36 37 37 37 35 34 36 34 37 37 37 33 33 33 36 37 38 37 39 37 39 39 39 39 39 39 37 37 37 39 38 35 33 32 32 32 28 28 28 19 16 Thank you, Arif ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [January 22, 2013, 1:53pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/12 "2013-01-22T13:53:26Z")
What version of 454 are you using? ---
**Author:** ![arifch](https://avatars.discourse-cdn.com/v4/letter/a/8797f3/32.png) [@arifch](https://forum.mothur.org/u/arifch)\ **Post date:** [January 23, 2013, 6:48am UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/13 "2013-01-23T06:48:51Z")
GS FLX Titanium ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [January 23, 2013, 6:35pm UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/14 "2013-01-23T18:35:57Z")
I suspect your sequences are bad. The machine is telling you that your reads are short (length=57) and the flowgram you sent has a “noisy” base at position 21 (0.68). I would suggest you talk with your sequence provider about what went wrong in this run. Pat ---
**Author:** ![arifch](https://avatars.discourse-cdn.com/v4/letter/a/8797f3/32.png) [@arifch](https://forum.mothur.org/u/arifch)\ **Post date:** [January 26, 2013, 8:22am UTC](https://forum.mothur.org/t/problem-of-trim-flows-command/975/15 "2013-01-26T08:22:59Z")
I’ll do that. Thank you so much for your help. arif