mothur

Oligo file construction from a study

Hello,
I am trying to recreate and study where they used modified 515f and 806r primers. I am creating the oligos files but the sequences given for a sample set are for example:

515 forward = GCCTTGCCAGCCCGCTCAGGTGTGCCAGCMGCCGCGGTAA;
806r = GCCTCCCTCGCGCCATCAGCTCGCGGGGACTACVSGGGTATCTAAT;

I did a search and found which are actually the primer sequences within these two strings, but we are clearly having adaptors and linkers in both forward and reverse. Should I list both barcodes in the file (basically two barcodes for one sample)?

Thank you

You can remove adapters and linkers within mothur using the linkers and spacers parameters in the https://mothur.org/wiki/Oligos_File#Linkers.

If you post a sample sequence you want these primers removed from, I can give you a more detailed response?

Here are a couple of of reads from pyrosequencing in one sample

GN85KWK04I5YLV rank=0000045 x=3641.0 y=1249.0 length=168
GGGACGTACCGGGTAGTCTAATCCCTTTCGCTCCCCTCGGCTTTCGTCCATGAGCGTCAGTTATGGCCCAGCAGAGCGCCTTCGCCACTGGTGTTCTTCCCGATATCTACGCATTTCACCGCTACACCGGGAATTCCCTCTGCCCCTACCACACTCAAGCCTT

the primer used with barcodes listed for them are

515 forward = GCCTTGCCAGCCCGCTCAGGT GTGCCAGCMGCCGCGGTAA; 806r = GCCTCCCTCGCGCCATCAGTGTAGGG GGACTACVSGGGTATCTAAT;

I 515 forward primer is the same for the other samples and only 806r varies in some lenght (which I believe must be the barcodes)

How should a oligo file should look like?
Thankyou

Hi,

I don’t see either primer sequence in your sequence. Is this from a raw read or has it already been trimmed? Do you know which primer they sequenced off of? I assume it’s the 806r since you think its the one with the barcode

Pat

Yes, they listed as a raw reads but I as you say I think that they have already trimmed the barcodes when demultiplexing, because I got 12 different fasta files, one per each type of sample.

I can see that most of the reads start with the reverse primer 806R = GGACTACHVGGGTWTCTAAT, I ended up doing a trial were I just created a oligo file listing this sequence as forward and did not list the barcodes. And it seems to work.

Maria