# how to select minimum and maximum length of reads from summary seqs **URL:** \ **Category:** Theory behind mothur\ **Created:** [March 22, 2017, 2:34pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178 "2017-03-22T14:34:20Z")\ **Posts on this page:** 7\ **Page:** 1
**Author:** ![unique](https://avatars.discourse-cdn.com/v4/letter/u/f4b2a3/32.png) [@unique](https://forum.mothur.org/u/unique)\ **Post date:** [March 22, 2017, 2:34pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/1 "2017-03-22T14:34:20Z")
Dear folks, I am new to analyze for micro biome data. I am trying to use mothur for my analysis. I have MiSeq paired (fastq) microbiome data. After using contigs and summary.seqs command i need to screen the sequences from my reads. The sumary file look like this: ```nohighlight mothur > summary.seqs(fasta=stability.trim.contigs.fasta) Using 2 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 1 35 35 0 3 1 2.5%-tile: 1 290 290 0 4 98245 25%-tile: 1 458 458 0 4 982449 Median: 1 460 460 1 6 1964897 75%-tile: 1 465 465 4 6 2947345 97.5%-tile: 1 466 466 22 7 3831548 Maximum: 1 602 602 59 289 3929792 Mean: 1 450.165 450.165 3.55126 5.35893 # of Seqs: 3929792 Output File Names: /Users/Destiny/Desktop/MicroBiome/OurData/stability.trim.contigs.summary ``` This point i need to select my minimum and maximum length in order to run screen.seqs but seeing summary output i am confused to select these lengths due to i read that microbiome reads supposed to have 250-300 bp and here i am seeing maximum length is about 600bp. please help. ---
**Author:** ![Kendra](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/kendra/32/112_2.png) [@Kendra](https://forum.mothur.org/u/Kendra)\ **Post date:** [March 22, 2017, 3:21pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/2 "2017-03-22T15:21:06Z")
What did you sequence? I’m guessing you did v4-6 rather than just v4? ---
**Author:** ![unique](https://avatars.discourse-cdn.com/v4/letter/u/f4b2a3/32.png) [@unique](https://forum.mothur.org/u/unique)\ **Post date:** [March 22, 2017, 3:49pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/3 "2017-03-22T15:49:56Z")
dear kmitchell, The sequencing was done using V3-V4 (for bacteria and archaea - Takahashi et al. 2014). Here i like to ask one more thing. As sequenced was done using forward and reverse primers so i need to clip these adapters using such as cutadpat program and then use mothur or i should not bother about trimming adapters before mothur? We used illumina standard primers which are: adapter F: TCGTCGGCAGCGTCAGATGTGTATAAGAGA adapter R: GTCTCGTGGGCTCGGAGATGTGTATAAGAG pro341F CCTACGGGNBGCASCAG pro805R GACTACNVGGGTATCTAATCC _Reference (table 1)_ _[http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0105592#pone-0105592-t001](http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0105592#pone-0105592-t001)_ Thanks in advance ---
**Author:** ![Kendra](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/kendra/32/112_2.png) [@Kendra](https://forum.mothur.org/u/Kendra)\ **Post date:** [March 22, 2017, 4:45pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/4 "2017-03-22T16:45:41Z")
Did you use custom sequencing primers (al.la Kozich/Caporasso) or illumina standard? Custom primers generally mean that pcr primers aren’t sequenced, standard primers mean pcr primers are sequenced. ---
**Author:** ![Kendra](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/kendra/32/112_2.png) [@Kendra](https://forum.mothur.org/u/Kendra)\ **Post date:** [March 22, 2017, 4:47pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/5 "2017-03-22T16:47:44Z")
to answer you original question, I’d trim above 465 or 470 and below 400. Not sure about minimum, v4 usually doesn’t need a min length trim ---
**Author:** ![unique](https://avatars.discourse-cdn.com/v4/letter/u/f4b2a3/32.png) [@unique](https://forum.mothur.org/u/unique)\ **Post date:** [March 23, 2017, 10:52am UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/6 "2017-03-23T10:52:12Z")
Thank you for your kind reply i would go with your suggestion and take only maximum length for screen.seqs. Moreover please take a look of my second question regarding primers/adpater triiming, i have just updated. Thanks once again and looking forward for your answer/view regarding trimming apadters along with quality (\>20) prior using mothur. Note: the idea was found in this paper: > **[Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene...](https://journals.plos.org/plosone/article?id=10.1371%2Fjournal.pone.0094249)** > > The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower... _“The V4-V5 Illumina datasets were initially demultiplexed using MiSeq Reporter v2.0. The sequences corresponding to the forward and reverse primers were trimmed from the demultiplexed reads using cutadapt ([http://code.google.com/p/cutadapt/](http://code.google.com/p/cutadapt/)) using similar stringency settings to those used for the 454 sequences. The trimmed read pairs were then merged into single contigs using SeqPrep ([https://github.com/jstjohn/SeqPrep](https://github.com/jstjohn/SeqPrep)) followed by a length-filtering step prior to analysis with QIIME. The Illumina V4 read pairs were merged and length filtered in a similar manner as the V4-V5 reads to form single contigs prior to being demultiplexed with QIIME. Reads from all datasets were quality filtered using a Q20 minimum value during demultiplexing.”_ ---
**Author:** ![westcott](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/westcott/32/18_2.png) [@westcott](https://forum.mothur.org/u/westcott)\ **Post date:** [March 24, 2017, 7:09pm UTC](https://forum.mothur.org/t/how-to-select-minimum-and-maximum-length-of-reads-from-summary-seqs/3178/7 "2017-03-24T19:09:57Z")
You can trim the primers using the make.contigs command with an oligos file, [https://mothur.org/wiki/Oligos\_File#Paired\_Primers](https://mothur.org/wiki/Oligos_File#Paired_Primers). The make.contigs command also has parameters to allow you to trim using the quality scores, [https://mothur.org/wiki/Make.contigs#insert](https://mothur.org/wiki/Make.contigs#insert) and [https://mothur.org/wiki/Make.contigs#deltaq](https://mothur.org/wiki/Make.contigs#deltaq).