# Co-ordinates for aligning v5-v7 region

**URL:** <https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928>\
**Category:** Uncategorized\
**Created:** [August 25, 2023, 1:14am UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928 "2023-08-25T01:14:21Z")\
**Posts on this page:** 14\
**Page:** 1

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 25, 2023, 1:14am UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/1 "2023-08-25T01:14:21Z")

</div>

Hi, all. We amplified the V5-V7 region of 16srRNA with our root samples using the primers (799F) AACMGGATTAGATACCCKG and (1193R) ACGTCATCCCCACCTTCC. I tried to find the co-ordinates in Silva bacteria to align my sequences but each time I try to customize it, my mothur closes. Any idea on the start and end points to align my V5-V7 sequences?

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [August 28, 2023, 7:56pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/2 "2023-08-28T19:56:31Z")

</div>

Hi Ananta,

Are you following this tutorial?

> **[Customize your reference alignment for your favorite region](https://mothur.org/blog/2016/Customization-for-your-region/)**
>
> The website that supports the mothur software program - one of the most widely used tools for analyzing 16S rRNA gene sequence data. Step inside to learn how to use the software, get help, and join our community!

Can you post how far you’ve gotten before you run into problems?

Thanks,  
Pat

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 28, 2023, 8:20pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/3 "2023-08-28T20:20:00Z")

</div>

Dr Pat,

Yes I am following the protocol. Even just now, I along with a professor of Molecular Biology here at USU tried but the same happened.

I have attached herewith the screenshot of the problem.  
Regards

 ![mothur.jpg](https://canada1.discourse-cdn.com/flex036/uploads/mothur/original/1X/ef8d47620a962c6e86ba7234e6d3b27e0f52358f.jpeg)

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [August 28, 2023, 8:37pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/4 "2023-08-28T20:37:59Z")

</div>

Can you post the contents of the fasta file you are trying to align?

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 28, 2023, 8:56pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/5 "2023-08-28T20:56:28Z")

</div>

I have attached herewith the the e coli fasta which I obtained from [https://www.ncbi.nlm.nih.gov/nuccore/174375?report=fasta](https://www.ncbi.nlm.nih.gov/nuccore/174375?report=fasta) ; along with list of primers and the E coli V5-V7 fasta which I used to align. The forward primer ends at 798th base and the reverse primer ends at 1176th base and hence the sequence I used is from 799th to 1175th base.

(Attachment ecoli.fasta.txt is missing)

(Attachment ecoli\_V5-V7.fasta.txt is missing)

(Attachment V5-V7.oligos.txt is missing)

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 28, 2023, 9:01pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/6 "2023-08-28T21:01:45Z")

</div>

I think the previous attachments failed. So, I have attached here with a word file of the same.

Regards

(Attachment V5-V7.docx is missing)

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 28, 2023, 11:06pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/7 "2023-08-28T23:06:26Z")

</div>

gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga

> [@pschloss](#):
>
> Can you post the contents of the fasta file you are trying to align?

gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [August 28, 2023, 11:54pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/8 "2023-08-28T23:54:59Z")

</div>

The first line needs to start with a `>` followed by the name of the sequence…

```auto
> ecoli
gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtc
gaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagc
atgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtg
ccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaac
gagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga

```

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 29, 2023, 4:15am UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/10 "2023-08-29T04:15:05Z")

</div>

![Capture](https://canada1.discourse-cdn.com/flex036/uploads/mothur/original/1X/4f02db1b8eeb8b254d7cf5a9fad729aa3b20a7cc.jpeg)  
My computer screen seems like this for 3 hours , could not proceed.

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 29, 2023, 1:27pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/11 "2023-08-29T13:27:50Z")

</div>

Is it not possible to align our sequences to whole silva bacteria , I could not proceed to find out the co-ordinates I required for aligning V5-V7 region. I left the computer on for whole night and there was no progress at all.

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [August 29, 2023, 2:46pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/12 "2023-08-29T14:46:37Z")

</div>

Can you post everything you’ve done starting from the beginning? I can’t see what you’re doing and your descriptions aren’t clear enough for me to understand where you are getting hung up. Could you possibly attach ecoli\_V5-V7.fasta.txt?

Pat

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [August 29, 2023, 6:18pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/13 "2023-08-29T18:18:37Z")

</div>

I am trying to find the co-ordinates in silva bacteria to align my V5-V7 amplified 16srRNA sequences. Let me make clear what I did:

I obtained the E coli 16sr RNA from the link here [Escherichia coli 16S ribosomal RNA, complete sequence - Nucleotide - NCBI](https://www.ncbi.nlm.nih.gov/nuccore/174375?report=fasta), and I trimmed the E coli 16srRNA sequence using the 799F (AACMGGATTAGATACCCKG) and 1193R (ACGTCATCCCCACCTTCC). Then the resulting E coli V5-V7 fasta.txt was used to align against the silva.bacteria.fasta and also against silva.seed\_v123. Doing that, the Mothur proceeded to some steps and after that I could only see a vertical stack of 0’s (zeros) in the left corner of my computer screen for 4-5 hours; still I left the computer on for the whole night but the step did not proceed.  
The ecoli-V5-V7.fasta I used was

> ecoli  
> gtagtccacgccgtaaacgatgtcgacttggaggttgtgcccttgaggcgtggcttccggagctaacgcgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctggtcttgacatccacggaagttttcagagatgagaatgtgccttcgggaaccgtgagacaggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacgagcgcaacccttatcctttgttgccagcggtccggccgggaactcaaaggagactgccagtgataaactgga

 ![Capture](https://canada1.discourse-cdn.com/flex036/uploads/mothur/original/1X/d70f18d9f48a8f76c136b4dce7c90a8b2c10c8fd.jpeg)

---

<div class="post-metadata">

**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\
**Post date:** [September 1, 2023, 8:16pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/15 "2023-09-01T20:16:22Z")

</div>

I’m not sure what was going wrong for you. Were you perhaps saving `ecoli-V5-V7.fasta` in word? Regardless, here’s what I got…

```auto
mothur > align.seqs(fasta=ecoli-V5-V7.fasta, reference = silva.bacteria.fasta)

Using 10 processors.

Reading in the silva.bacteria.fasta template sequences...	DONE.
It took 11 to read 14956 sequences.

Aligning sequences from ecoli-V5-V7.fasta ...
1
It took 0 secs to align 1 sequences.

It took 1 seconds to align 1 sequences.

Output File Names: 
ecoli-V5-V7.align
ecoli-V5-V7.align_report

mothur > summary.seqs()
Using ecoli-V5-V7.align as input file for the fasta parameter.

Using 10 processors.

		Start	End	NBases	Ambigs	Polymer	NumSeqs
Minimum:	25292	37693	377	0	5	1
2.5%-tile:	25292	37693	377	0	5	1
25%-tile:	25292	37693	377	0	5	1
Median: 25292	37693	377	0	5	1
75%-tile:	25292	37693	377	0	5	1
97.5%-tile:	25292	37693	377	0	5	1
Maximum:	25292	37693	377	0	5	1
Mean:	25292	37693	377	0	5
# of Seqs:	1

It took 0 secs to summarize 1 sequences.

Output File Names:
ecoli-V5-V7.summary

```

---

<div class="post-metadata">

**Author:** ![Ananta](https://avatars.discourse-cdn.com/v4/letter/a/ba9def/32.png) [@Ananta](https://forum.mothur.org/u/Ananta)\
**Post date:** [September 1, 2023, 8:40pm UTC](https://forum.mothur.org/t/co-ordinates-for-aligning-v5-v7-region/21928/16 "2023-09-01T20:40:29Z")

</div>

I saved it in text file in the same folder where I have mothur files. Anyways, thank you very much Pat, I appreciate your help so much. You are the best .
