# 18S Sequences Too Short After Alignment with SILVA nr\_v138\_2 – Mothur v1.48.0 **URL:** \ **Category:** mothur bugs\ **Created:** [June 4, 2025, 8:05am UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335 "2025-06-04T08:05:20Z")\ **Posts on this page:** 8\ **Page:** 1
**Author:** ![Hornes](https://avatars.discourse-cdn.com/v4/letter/h/d07c76/32.png) [@Hornes](https://forum.mothur.org/u/Hornes)\ **Post date:** [June 4, 2025, 8:05am UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/1 "2025-06-04T08:05:20Z")
Hello We’re trying to process 18S sequences (V1-V2 regions of the 18S rRNA gene, Primer Euk82F and Euk516F) with Mothur, version 1.48.0. After alignment on the Silva.nr\_v138\_2.align database, we get too short sequences with 95% title containing 450 bp (the maxlenght given in screen.seq) before alignment and 25% tile containing 10 bp. ```auto mothur > summary.seqs(fasta=18s.trim.contigs.fasta, count=18s.contigs.count_table) Using 40 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 1 282 282 0 3 1 2.5%-tile: 1 399 399 1 4 86005 25%-tile: 1 445 445 6 4 860046 Median: 1 446 446 8 5 1720091 75%-tile: 1 450 450 11 6 2580136 97.5%-tile: 1 454 454 20 7 3354177 Maximum: 1 567 567 78 264 3440181 Mean: 1 444 444 8 5 # of unique seqs: 3440181 total # of seqs: 3440181 It took 112 secs to summarize 3440181 sequences. Output File Names: 18s.trim.contigs.summary mothur > screen.seqs(fasta=18s.trim.contigs.fasta, count=18s.contigs.count_table,summary=18s.trim.contigs.summary, maxambig=0, maxlength=450, maxhomop=8) mothur > summary.seqs(count=current) Using 18s.contigs.good.count_table as input file for the count parameter. Using 18s.trim.contigs.good.fasta as input file for the fasta parameter. Using 40 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 1 284 284 0 3 1 2.5%-tile: 1 293 293 0 3 930 25%-tile: 1 307 307 0 3 9297 Median: 1 309 309 0 4 18594 75%-tile: 1 312 312 0 4 27891 97.5%-tile: 1 422 422 0 7 36258 Maximum: 1 450 450 0 8 37187 Mean: 1 314 314 0 3 # of unique seqs: 37187 total # of seqs: 37187 It took 1 secs to summarize 37187 sequences. mothur > align.seqs(fasta=18s.trim.contigs.good.unique.fasta, reference=silva.nr_v132.align) mothur > summary.seqs(fasta=18s.trim.contigs.good.unique.align, count=18s.trim.contigs.good.count_table) Using 40 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 0 0 0 0 1 1 2.5%-tile: 1046 1056 4 0 1 930 25%-tile: 1046 1083 8 0 2 9297 Median: 43053 43116 11 0 2 18594 75%-tile: 43096 43116 16 0 3 27891 97.5%-tile: 43112 43116 422 0 6 36258 Maximum: 43116 43116 450 0 8 37187 Mean: 26606 27490 45 0 2 # of unique seqs: 29090 total # of seqs: 37187 It took 6 secs to summarize 37187 sequences. ``` In conclusion, we obtain sequences that are too short after alignment for the 18s ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [June 4, 2025, 4:32pm UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/2 "2025-06-04T16:32:38Z")
Hi there, Could you possibly try using [flip=T](https://mothur.org/wiki/align.seqs/#flip-and-threshold) in align.seqs? Also, do you know how these sequences were generated? Pat ---
**Author:** ![Hornes](https://avatars.discourse-cdn.com/v4/letter/h/d07c76/32.png) [@Hornes](https://forum.mothur.org/u/Hornes)\ **Post date:** [June 5, 2025, 9:39am UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/3 "2025-06-05T09:39:57Z")
Hello I have redone the steps by including the flip=T in align.seq , and I get the same result. ```auto mothur > screen.seqs(fasta=18s.trim.contigs.fasta, count=18s.contigs.count_table,summary=18s.trim.contigs.summary, maxambig=0, maxlength=550, maxhomop=8) mothur > summary.seqs(count=current) Using 18s.contigs.good.count_table as input file for the count parameter. Using 18s.trim.contigs.good.fasta as input file for the fasta parameter. Using 32 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 1 284 284 0 3 1 2.5%-tile: 1 293 293 0 3 934 25%-tile: 1 307 307 0 3 9334 Median: 1 309 309 0 4 18668 75%-tile: 1 312 312 0 4 28001 97.5%-tile: 1 422 422 0 7 36401 Maximum: 1 545 545 0 8 37334 Mean: 1 315 315 0 3 # of unique seqs: 37334 total # of seqs: 37334 It took 1 secs to summarize 37334 sequences. Output File Names: 18s.trim.contigs.good.summary mothur > align.seqs(fasta=18s.trim.contigs.good.unique.fasta, reference= silva.nr_v138_2.align, flip=T) mothur > summary.seqs(fasta=18s.trim.contigs.good.unique.align, count=18s.trim.contigs.good.count_table) Using 32 processors. Start End NBases Ambigs Polymer NumSeqs Minimum: 0 0 0 0 1 1 2.5%-tile: 1044 1058 4 0 1 934 25%-tile: 4728 11885 9 0 2 9334 Median: 43056 43116 11 0 2 18668 75%-tile: 43096 43116 18 0 3 28001 97.5%-tile: 43112 43116 422 0 6 36401 Maximum: 43116 43116 498 0 8 37334 Mean: 30148 31051 46 0 2 # of unique seqs: 29224 total # of seqs: 37334 It took 6 secs to summarize 37334 sequences. Output File Names: 18s.trim.contigs.good.unique.summary ``` The sequences were generated on an Illumina Miseq platform with paired-end reads. Thanks ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [June 9, 2025, 2:02pm UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/4 "2025-06-09T14:02:59Z")
Can you post one of the sequences that is getting truncated during alignment? Pat ---
**Author:** ![Hornes](https://avatars.discourse-cdn.com/v4/letter/h/d07c76/32.png) [@Hornes](https://forum.mothur.org/u/Hornes)\ **Post date:** [June 10, 2025, 8:28am UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/5 "2025-06-10T08:28:05Z")
Hello In “18s.trim.contigs.good.unique.align\_report” M07192\_54\_000000000-LLDG7\_1\_2118\_15178\_15837 307 AY437674.FmbDicho 1714 kmer 7.00 needleman 1 11 1794 1804 11 0 0 0 72.72 In “18s.trim.contigs.good.unique.fasta” > M07192\_54\_000000000-LLDG7\_1\_2118\_15178\_15837 ee=2.90838 > GGAGCAAGGAACCTGGGAATGGCTCGTAATGAAATTAGGCAAACTAAAGTGTCCTACCAGTTTGGCGTGCATTTGCGTACTCCCAGTTACAAGCAAACGCACATACAGACACTTGTTCGATGGTTTCCACGAGACCTGGCTTGCCTAATGGATGTTGACGGTTTGTGTGTGTGTGTGTGAGAGAGTGAGTGAATTGAAGTAAGTACGTCAATGGGCTTCACACCGCACAGCACCGAGAGAGAAGGAGTGTGTTCGGAGCTTGCGGTTCCGCTGCGTCTACCTCGGAGGGCAAGTCTGGTCTGTCTCT Thanks ---
**Author:** ![Hornes](https://avatars.discourse-cdn.com/v4/letter/h/d07c76/32.png) [@Hornes](https://forum.mothur.org/u/Hornes)\ **Post date:** [June 10, 2025, 8:33am UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/6 "2025-06-10T08:33:28Z")
In “18s.trim.contigs.good.unique.align” > M07192\_54\_000000000-LLDG7\_1\_2118\_15178\_15837 I had to delete the beginnings and ends of empty alignments due to a lack of characters to enter when replying. …GG–A-GC-A-A----GG-AA… ---
**Author:** ![pschloss](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/pschloss/32/4_2.png) [@pschloss](https://forum.mothur.org/u/pschloss)\ **Post date:** [June 10, 2025, 12:34pm UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/7 "2025-06-10T12:34:47Z")
Thanks - I wonder if there’s a problem with your sequencing. I tried blasting your sequence against nt (blastn) and nr (blastx) and there were no significant hits. ```auto GGAGCAAGGAACCTGGGAATGGCTCGTAATGAAATTAGGCAAACTAAAGTGTCCTACCAGTTT GGCGTGCATTTGCGTACTCCCAGTTACAAGCAAACGCACATACAGACACTTGTTCGATGGTTT CCACGAGACCTGGCTTGCCTAATGGATGTTGACGGTTTGTGTGTGTGTGTGTGAGAGAGTGAG TGAATTGAAGTAAGTACGTCAATGGGCTTCACACCGCACAGCACCGAGAGAGAAGGAGTGTGT TCGGAGCTTGCGGTTCCGCTGCGTCTACCTCGGAGGGCAAGTCTGGTCTGTCTCT ``` You can find the blast report here: [NCBI Blast:Nucleotide Sequence](https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=4G9M52P8013) What kind of samples are you sequencing? Do you know if the run quality was good? Pat ---
**Author:** ![system](https://yyz2.discourse-cdn.com/flex036/user_avatar/forum.mothur.org/system/32/2_2.png) [@system](https://forum.mothur.org/u/system)\ **Post date:** [June 20, 2025, 12:35pm UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335/8 "2025-06-20T12:35:28Z")
This topic was automatically closed 10 days after the last reply. New replies are no longer allowed.