# Latest **URL:** https://forum.mothur.org/latest.md?page=1 [Latest](https://forum.mothur.org/latest.md) · [Categories](https://forum.mothur.org/categories.md) **Page:** 2 --- ## [Mixed 16S/ITS kit but reads look overwhelmingly V3–V4 — how to verify and subset per region?](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377)
**Author:** [@OtyLam](https://forum.mothur.org/u/OtyLam)\ **Replies:** 1\ **Last updated:** [October 16, 2025, 1:25pm UTC](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377 "2025-10-16T13:25:59Z")
Hello everyone, I am new to metagenomics bioinformatic analysis, as I’m willing to study soil samples microbial diversity. I have paired-end FASTQs sequenced with a kit that can target three regions (16S V3–V4, 16S V4–V… --- ## [Rarefaction in mothursop](https://forum.mothur.org/t/rarefaction-in-mothursop/22372)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [October 14, 2025, 12:45pm UTC](https://forum.mothur.org/t/rarefaction-in-mothursop/22372 "2025-10-14T12:45:52Z")
Hello! I previously asked when to use the sub sampled data and sadly I am still confused. I was told “Things like amova/homova/pcoa/shannon/simpson/richness are calculated using dist.shared and summary.single using raref… --- ## [Appropriate length filtering strategy for 16S V4–V5 (515F–907R) amplicons: percentile vs fixed cutoffs?](https://forum.mothur.org/t/appropriate-length-filtering-strategy-for-16s-v4-v5-515f-907r-amplicons-percentile-vs-fixed-cutoffs/22366)
**Author:** [@Echo](https://forum.mothur.org/u/Echo)\ **Replies:** 3\ **Last updated:** [October 9, 2025, 1:55pm UTC](https://forum.mothur.org/t/appropriate-length-filtering-strategy-for-16s-v4-v5-515f-907r-amplicons-percentile-vs-fixed-cutoffs/22366 "2025-10-09T13:55:31Z")
Hi all, I am processing amplified 16S rRNA gene data (targeting the V4–V5 region with primers 515F GTGCCAGCMGCCGCGGTAA and 907R CCGTCAATTCCTTTGAGTTT). My pipeline so far: Removed adapters and primers. Filtered reads w… --- ## [Error during pcr.seqs step: Error in reading your fastafile, at position -1. Blank name](https://forum.mothur.org/t/error-during-pcr-seqs-step-error-in-reading-your-fastafile-at-position-1-blank-name/22364)
**Author:** [@sbelz](https://forum.mothur.org/u/sbelz)\ **Replies:** 5\ **Last updated:** [October 1, 2025, 1:22pm UTC](https://forum.mothur.org/t/error-during-pcr-seqs-step-error-in-reading-your-fastafile-at-position-1-blank-name/22364 "2025-10-01T13:22:11Z")
Hello all! I am rather new to Mothur and am looking to get some help resolving this issue. I’m using Mothur v1.48.3 and was running the pcr.seqs command: pcr.seqs(fasta= FILENAME.trim.contigs.fasta, count= FILENAME.con… --- ## [You did not provide a class](https://forum.mothur.org/t/you-did-not-provide-a-class/22363)
**Author:** [@Aris](https://forum.mothur.org/u/Aris)\ **Replies:** 9\ **Last updated:** [September 30, 2025, 1:16pm UTC](https://forum.mothur.org/t/you-did-not-provide-a-class/22363 "2025-09-30T13:16:04Z")
I keep running the mothur function but it keeps saying that I did not provide a “class” even though I do have a class variable in the data frame --- ## [UD Index's and amplicon length](https://forum.mothur.org/t/ud-indexs-and-amplicon-length/22362)
**Author:** [@noah472](https://forum.mothur.org/u/noah472)\ **Replies:** 5\ **Last updated:** [September 22, 2025, 2:44pm UTC](https://forum.mothur.org/t/ud-indexs-and-amplicon-length/22362 "2025-09-22T14:44:46Z")
Hi, I recently received data back from our first run switching from the Nextera i5 and i7 indexes to the IDT UD indexes from Illumina and have a problem when i run make.contigs. We have been using mothur for a long tim… --- ## [Sub.sample output use](https://forum.mothur.org/t/sub-sample-output-use/22361)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [September 20, 2025, 12:33am UTC](https://forum.mothur.org/t/sub-sample-output-use/22361 "2025-09-20T00:33:33Z")
Hi all! Ive done the Mothur MiSeq sop a million times now for my masters thesis and I am still a little unsure what the use of the output from sub.sample is? We use the output for Make.shared for Alpha and beta diversity… --- ## [Compare Samples With Sequences of Different Lengths?](https://forum.mothur.org/t/compare-samples-with-sequences-of-different-lengths/22360)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 3\ **Last updated:** [August 25, 2025, 1:48pm UTC](https://forum.mothur.org/t/compare-samples-with-sequences-of-different-lengths/22360 "2025-08-25T13:48:04Z")
Hello, this post is mainly a question about how to compare samples from different experiments/16S regions. I’m trying to conduct a meta-analysis of different studies looking at the same biological process but with diffe… --- ## [AMOVA Tutorial Sample design File Missing Headers](https://forum.mothur.org/t/amova-tutorial-sample-design-file-missing-headers/22359)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 0\ **Last updated:** [August 25, 2025, 7:42am UTC](https://forum.mothur.org/t/amova-tutorial-sample-design-file-missing-headers/22359 "2025-08-25T07:42:57Z")
Hello, I was trying to follow the AMOVA command tutorial but the provided design file did not seem to be formatted correctly. All it needed was the “group” and “treatment” headers, so a very small issue. Cheers. --- ## [Issue with bacterial classification using Mothur v1.48.3 and SILVA v138.2](https://forum.mothur.org/t/issue-with-bacterial-classification-using-mothur-v1-48-3-and-silva-v138-2/22356)
**Author:** [@Berrais](https://forum.mothur.org/u/Berrais)\ **Replies:** 2\ **Last updated:** [August 19, 2025, 8:33pm UTC](https://forum.mothur.org/t/issue-with-bacterial-classification-using-mothur-v1-48-3-and-silva-v138-2/22356 "2025-08-19T20:33:20Z")
Hello, I would like to report an issue encountered with the classify.seqs command in Mothur version 1.48.3, using the SILVA v138.2 database (Full-length sequences and taxonomy references). We use the ZymoBIOMICS Microb… --- ## [Align.seq Process Killed](https://forum.mothur.org/t/align-seq-process-killed/22358)
**Author:** [@Ken](https://forum.mothur.org/u/Ken)\ **Replies:** 2\ **Last updated:** [August 19, 2025, 4:33pm UTC](https://forum.mothur.org/t/align-seq-process-killed/22358 "2025-08-19T16:33:26Z")
Hi All, I am working to align 16s v4 rRNA gene ASVs. I have successfully done pcr.seqs as described below. I have also read in my ASVs.fa file to ensure that it seems reasonable (using summary.seqs) as described below. … --- ## [Pcr.seqs command error](https://forum.mothur.org/t/pcr-seqs-command-error/22352)
**Author:** [@1234](https://forum.mothur.org/u/1234)\ **Replies:** 1\ **Last updated:** [August 1, 2025, 12:45pm UTC](https://forum.mothur.org/t/pcr-seqs-command-error/22352 "2025-08-01T12:45:26Z")
Hey Pat, While giving the command for pcr.seqs, the main prompt of the website shows that silva.bacteria.fasta should be used as reference (when V4 region was in question), but I visited the ‘blog post’, in which the si… --- ## [Classify.seqs() marking most sequences as unclassified](https://forum.mothur.org/t/classify-seqs-marking-most-sequences-as-unclassified/22351)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 2\ **Last updated:** [July 28, 2025, 6:57pm UTC](https://forum.mothur.org/t/classify-seqs-marking-most-sequences-as-unclassified/22351 "2025-07-28T18:57:03Z")
Hello, I am analyzing a sequencing experiment that used the V3-4 region using a functioning pipeline that (I think?) mostly follows the MiSeq SOP. Originally when I ran the pipeline everything seemed okay, but now I’m re… --- ## [Convert mothur taxonomy to NCBI tax ID](https://forum.mothur.org/t/convert-mothur-taxonomy-to-ncbi-tax-id/22349)
**Author:** [@gwidmer](https://forum.mothur.org/u/gwidmer)\ **Replies:** 1\ **Last updated:** [July 15, 2025, 4:44pm UTC](https://forum.mothur.org/t/convert-mothur-taxonomy-to-ncbi-tax-id/22349 "2025-07-15T16:44:28Z")
Hi, does anyone know a program that can convert a .cons.taxonomy file output by classify.otu to NCBI tax IDs? Example: Firmicutes(100);Erysipelotrichi(100);Erysipelotrichales(100);Erysipelotrichaceae(100);Allobaculum(100… --- ## [Pre.cluster 18S](https://forum.mothur.org/t/pre-cluster-18s/22345)
**Author:** [@Hornes](https://forum.mothur.org/u/Hornes)\ **Replies:** 3\ **Last updated:** [July 7, 2025, 6:28pm UTC](https://forum.mothur.org/t/pre-cluster-18s/22345 "2025-07-07T18:28:12Z")
Hello, I’m working with 18S sequences (R1 only good quality) from Illumina sequencing. I used the fastq.info command to extract the fasta sequences and then did all the commands in the Mothur tutorial without make.file … --- ## [Different Results When Using Different Number of Processors (make.contigs() w/t v.1.37.4 and v.1.48.3)](https://forum.mothur.org/t/different-results-when-using-different-number-of-processors-make-contigs-w-t-v-1-37-4-and-v-1-48-3/22342)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 1\ **Last updated:** [June 25, 2025, 5:22pm UTC](https://forum.mothur.org/t/different-results-when-using-different-number-of-processors-make-contigs-w-t-v-1-37-4-and-v-1-48-3/22342 "2025-06-25T17:22:36Z")
Preface: I am trying to replicate results from a publication that used mothur v.1.37.4. However, I ran into a bug(?) that resulted in variable results when using the command “make.contigs()” with different numbers of pro… --- ## [Silva.bacteria.fasta file](https://forum.mothur.org/t/silva-bacteria-fasta-file/22341)
**Author:** [@James146](https://forum.mothur.org/u/James146)\ **Replies:** 3\ **Last updated:** [June 25, 2025, 12:46pm UTC](https://forum.mothur.org/t/silva-bacteria-fasta-file/22341 "2025-06-25T12:46:44Z")
Hi I’m struggling to obtain the newest version of the SILVA reference file (v 138.2) from the SILVA reference files link. I can’t download ARB to my PC. Has anyone managed to follow the README file to obtain the silva.b… --- ## [Error in reading your fastafile, at position -1. Blank name](https://forum.mothur.org/t/error-in-reading-your-fastafile-at-position-1-blank-name/20231)
**Author:** [@f6mmah](https://forum.mothur.org/u/f6mmah)\ **Replies:** 7\ **Last updated:** [June 13, 2025, 2:33pm UTC](https://forum.mothur.org/t/error-in-reading-your-fastafile-at-position-1-blank-name/20231 "2025-06-13T14:33:27Z")
Hello all, I am a new user in mothur and I do not have any background and I hope you gonna help me. I used this command: mothur \> screen.seqs(fasta=stability.trim.contigs.good.unique.abund.align,count=stability.trim.… --- ## [Translate.seqs other code tables?](https://forum.mothur.org/t/translate-seqs-other-code-tables/22340)
**Author:** [@dporco](https://forum.mothur.org/u/dporco)\ **Replies:** 1\ **Last updated:** [June 13, 2025, 1:05pm UTC](https://forum.mothur.org/t/translate-seqs-other-code-tables/22340 "2025-06-13T13:05:51Z")
Hello I am working with invertebrates’ mitochondrial seqs (COI). The actual command translate.seqs is great but it is using a code table that give me a lot of stop codons because it is probably targeted at bacterial pla… --- ## [18S Sequences Too Short After Alignment with SILVA nr\_v138\_2 – Mothur v1.48.0](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335)
**Author:** [@Hornes](https://forum.mothur.org/u/Hornes)\ **Replies:** 6\ **Last updated:** [June 10, 2025, 12:34pm UTC](https://forum.mothur.org/t/18s-sequences-too-short-after-alignment-with-silva-nr-v138-2-mothur-v1-48-0/22335 "2025-06-10T12:34:47Z")
Hello We’re trying to process 18S sequences (V1-V2 regions of the 18S rRNA gene, Primer Euk82F and Euk516F) with Mothur, version 1.48.0. After alignment on the Silva.nr\_v138\_2.align database, we get too short sequence… --- ## [Inquiry on 16S rRNA Analysis Using Mothur and Data Trimming Techniques](https://forum.mothur.org/t/inquiry-on-16s-rrna-analysis-using-mothur-and-data-trimming-techniques/22333)
**Author:** [@Moh](https://forum.mothur.org/u/Moh)\ **Replies:** 1\ **Last updated:** [June 4, 2025, 4:27pm UTC](https://forum.mothur.org/t/inquiry-on-16s-rrna-analysis-using-mothur-and-data-trimming-techniques/22333 "2025-06-04T16:27:40Z")
I hope this message finds you well. I am currently conducting a meta-analysis involving various studies and am in the process of compiling all the data for 16S rRNA analysis using Mothur. I’m reaching out to seek your ex… --- ## [Opti\_mcc file confusion](https://forum.mothur.org/t/opti-mcc-file-confusion/22331)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 3\ **Last updated:** [May 20, 2025, 10:44pm UTC](https://forum.mothur.org/t/opti-mcc-file-confusion/22331 "2025-05-20T22:44:58Z")
Hi all! I am trying to understand all my outputs from mothur so I can understand which microbes are most abundant in my samples. Is this understanding below of these two files correct? The definition of size is in the Mi… --- ## [Merge.outs cannot merge for taxlevel 5(family)](https://forum.mothur.org/t/merge-outs-cannot-merge-for-taxlevel-5-family/22324)
**Author:** [@YanSun](https://forum.mothur.org/u/YanSun)\ **Replies:** 6\ **Last updated:** [May 15, 2025, 2:05pm UTC](https://forum.mothur.org/t/merge-outs-cannot-merge-for-taxlevel-5-family/22324 "2025-05-15T14:05:36Z")
Hi, When I use merge.otus, I was able to merge for taxlevel 2 (phylum), 3(class), 4(order), and 6(genus), with taxonomy and shared files as input. But taxlevel 5(family) gave me the same result as taxlevel 6 in the taxo… --- ## [Why use Consensus sequences](https://forum.mothur.org/t/why-use-consensus-sequences/22329)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 3\ **Last updated:** [May 14, 2025, 12:36pm UTC](https://forum.mothur.org/t/why-use-consensus-sequences/22329 "2025-05-14T12:36:51Z")
Hi All, I am new to this and I am confused about why consensus sequences are helpful rather than just the opti\_mcc.shared file. It does tell me more information and is more helpful but I am doing a project where I want t… --- ## [New SILVA file name](https://forum.mothur.org/t/new-silva-file-name/22330)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [May 14, 2025, 12:34pm UTC](https://forum.mothur.org/t/new-silva-file-name/22330 "2025-05-14T12:34:23Z")
Hi, I am rerunning the mothur miseq SOP and noticed that the new SILVA file is called “silva.nr\_v138\_2.align” and not silva.bacteria.fasta like the one in the SOP. I have never used a reference database before and have … --- ## [Cluster and cluster.split cannot convert to integer](https://forum.mothur.org/t/cluster-and-cluster-split-cannot-convert-to-integer/22328)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 6\ **Last updated:** [May 13, 2025, 6:23pm UTC](https://forum.mothur.org/t/cluster-and-cluster-split-cannot-convert-to-integer/22328 "2025-05-13T18:23:29Z")
Hi all I am trying to use cluster or cluster.seq on my data and It has worked before but I keep getting duplicates of otu’s in my data output so I was trying to see where I made an error and It keeps saying this for all … --- ## [How does sub.sample function works](https://forum.mothur.org/t/how-does-sub-sample-function-works/22323)
**Author:** [@EllistonV](https://forum.mothur.org/u/EllistonV)\ **Replies:** 5\ **Last updated:** [May 10, 2025, 5:49am UTC](https://forum.mothur.org/t/how-does-sub-sample-function-works/22323 "2025-05-10T05:49:56Z")
Hello, I just want to know how the sub.sample() function works. How does the function determines how many sequences to remove from each OTU/ASV? does it remove more sequences from larger ASVs; is there a ratio kept betw… --- ## [Chimera vsearch error](https://forum.mothur.org/t/chimera-vsearch-error/22128)
**Author:** [@sje062](https://forum.mothur.org/u/sje062)\ **Replies:** 10\ **Last updated:** [May 9, 2025, 3:35pm UTC](https://forum.mothur.org/t/chimera-vsearch-error/22128 "2025-05-09T15:35:23Z")
Hi, mothur is helpful and it might be obvious but, sorry, I cannot figure out how to make chimera.vsearch work. Please let me know a solution. My command and output with error message is shown below. I use mothur v.1.48… --- ## [Make.contigs runs out of memory](https://forum.mothur.org/t/make-contigs-runs-out-of-memory/22326)
**Author:** [@Shaun](https://forum.mothur.org/u/Shaun)\ **Replies:** 5\ **Last updated:** [May 6, 2025, 2:48pm UTC](https://forum.mothur.org/t/make-contigs-runs-out-of-memory/22326 "2025-05-06T14:48:49Z")
Using mothur v.1.48.0, I’m running out of memory with make.contigs and i did not expect it to use much memory. I have 612 samples with roughly 300 K reads each. It seemed to fail at the end, where i assume the count\_tabl… --- ## [Sequence file lost!](https://forum.mothur.org/t/sequence-file-lost/22312)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 5\ **Last updated:** [April 21, 2025, 1:38pm UTC](https://forum.mothur.org/t/sequence-file-lost/22312 "2025-04-21T13:38:40Z")
Hi everyone, I am new to mothur. I went through the entire workflow and was able to get taxonomy for my organisms and relative abundance. I remember their being a file with the actual sequences that helped us know the na… [Previous page](https://forum.mothur.org/latest.md) [Next page](https://forum.mothur.org/latest.md?page=2)