# Latest **URL:** https://forum.mothur.org/latest.md [Latest](https://forum.mothur.org/latest.md) · [Categories](https://forum.mothur.org/categories.md) --- ## [Welcome to the mothur forum](https://forum.mothur.org/t/welcome-to-the-mothur-forum/8)
**Author:** [@system](https://forum.mothur.org/u/system)\ **Replies:** 0\ **Last updated:** [October 10, 2018, 3:23pm UTC](https://forum.mothur.org/t/welcome-to-the-mothur-forum/8 "2018-10-10T15:23:44Z")
This is the discussion forum for the mothur software package. If you have any questions or ideas please post them here and someone from the community will get back to you. This board is open for anyone to respond to othe… --- ## [ASV of unexpected size](https://forum.mothur.org/t/asv-of-unexpected-size/22453)
**Author:** [@sje062](https://forum.mothur.org/u/sje062)\ **Replies:** 8\ **Last updated:** [September 16, 2026, 4:04pm UTC](https://forum.mothur.org/t/asv-of-unexpected-size/22453 "2026-09-16T16:04:46Z")
Hi mothur forum, my shared file has too many sequences in the largest ASV. The summary file looks fine. I am using mothur version 1.48.6, a PC and Windows. I am following the MiSeq SOP ( MiSeq SOP ). I make the ASVs by m… --- ## [Mothur Silva files](https://forum.mothur.org/t/mothur-silva-files/22449)
**Author:** [@jrthelusmond](https://forum.mothur.org/u/jrthelusmond)\ **Replies:** 1\ **Last updated:** [September 11, 2026, 3:05pm UTC](https://forum.mothur.org/t/mothur-silva-files/22449 "2026-09-11T15:05:29Z")
I am running mothur using silva 132. I downloaded the following files from both silva and rdp to run the program. I feel like some files are missing; can anyone check and let me know if I am missing something? I could no… --- ## [Alpha and beta diversity](https://forum.mothur.org/t/alpha-and-beta-diversity/22448)
**Author:** [@jrthelusmond](https://forum.mothur.org/u/jrthelusmond)\ **Replies:** 1\ **Last updated:** [September 1, 2026, 12:44pm UTC](https://forum.mothur.org/t/alpha-and-beta-diversity/22448 "2026-09-01T12:44:31Z")
Dear All, I have sequencing data from three compost sources and would like to compare their alpha and beta diversity to determine whether any source exhibits greater microbial diversity. I attempted to perform the analy… --- ## [Demultiplexing Minion data](https://forum.mothur.org/t/demultiplexing-minion-data/22446)
**Author:** [@dporco](https://forum.mothur.org/u/dporco)\ **Replies:** 4\ **Last updated:** [August 8, 2026, 3:25pm UTC](https://forum.mothur.org/t/demultiplexing-minion-data/22446 "2026-08-08T15:25:36Z")
Hello I am trying to demultiplex data from a Minion run with an oligo file (dual barcode tagging like “barcode AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT gr1\_rep3”) but I don’t know which command I can feed this … --- ## [Gaps "misplaced" with align seqs](https://forum.mothur.org/t/gaps-misplaced-with-align-seqs/22438)
**Author:** [@leocadio](https://forum.mothur.org/u/leocadio)\ **Replies:** 8\ **Last updated:** [July 17, 2026, 5:33pm UTC](https://forum.mothur.org/t/gaps-misplaced-with-align-seqs/22438 "2026-07-17T17:33:22Z")
Hi all Over the years, I noticed that align.seqs fails to be consistent in treating gaps. In V4, for example, I run align gaps against SILVA (at it some or trimmed to V4) and one can get, on a conserved region, somethin… --- ## [AWS EC2 Community mothur AMI - still an option?](https://forum.mothur.org/t/aws-ec2-community-mothur-ami-still-an-option/22437)
**Author:** [@jmcbeth](https://forum.mothur.org/u/jmcbeth)\ **Replies:** 3\ **Last updated:** [July 1, 2026, 3:14pm UTC](https://forum.mothur.org/t/aws-ec2-community-mothur-ami-still-an-option/22437 "2026-07-01T15:14:08Z")
Hey! Just wondering if there should still be mothur AMIs available on Amazon AWS EC2 community. I can’t find it there, wondering if this is still a thing! --- ## [Customizing latest SILVA for V4](https://forum.mothur.org/t/customizing-latest-silva-for-v4/22416)
**Author:** [@Kumari\_Richa](https://forum.mothur.org/u/Kumari_Richa)\ **Replies:** 3\ **Last updated:** [May 21, 2026, 12:07pm UTC](https://forum.mothur.org/t/customizing-latest-silva-for-v4/22416 "2026-05-21T12:07:44Z")
Hi mothur team, I am processing 16S V4 data (515F/806R, ~253 bp reads). I want to customize the full-length latest SILVA v138.2 reference database to create a streamlined V4-only reference file. What are the recommende… --- ## [Agglomerating OTUs by taxonomic rank](https://forum.mothur.org/t/agglomerating-otus-by-taxonomic-rank/22410)
**Author:** [@RiboRings](https://forum.mothur.org/u/RiboRings)\ **Replies:** 2\ **Last updated:** [May 4, 2026, 1:22pm UTC](https://forum.mothur.org/t/agglomerating-otus-by-taxonomic-rank/22410 "2026-05-04T13:22:10Z")
Hi! I recently started learning mothur and I am testing its functionality using an OTU dataset that I exported from Bioconductor mia (here are some examples). I am currently looking for a function in mothur to agglomer… --- ## [Make.contigs doesn’t create stability.contigs.count\_table](https://forum.mothur.org/t/make-contigs-doesn-t-create-stability-contigs-count-table/22409)
**Author:** [@Raj](https://forum.mothur.org/u/Raj)\ **Replies:** 7\ **Last updated:** [March 19, 2026, 1:00pm UTC](https://forum.mothur.org/t/make-contigs-doesn-t-create-stability-contigs-count-table/22409 "2026-03-19T13:00:47Z")
Hi, I couldn’t find stability.contigs.count\_table to run commands like summary.seqs(fasta=stability.trim.contigs.fasta, count=stability.contigs.count\_table). I am using version1.48.5. need suggestions/advise please. --- ## [Chimera.vsearch does not update count table](https://forum.mothur.org/t/chimera-vsearch-does-not-update-count-table/22407)
**Author:** [@JHC](https://forum.mothur.org/u/JHC)\ **Replies:** 3\ **Last updated:** [March 8, 2026, 7:31pm UTC](https://forum.mothur.org/t/chimera-vsearch-does-not-update-count-table/22407 "2026-03-08T19:31:52Z")
Hello: I am following the MiSeq SOP using mothur v.1.48.5 (pre-compiled). Everything is going well until I get to the chimera.vsearch step. It appears that the remove.seqs command is not updating the count table that I … --- ## [Trim.seqs removes group membership](https://forum.mothur.org/t/trim-seqs-removes-group-membership/22408)
**Author:** [@JHC](https://forum.mothur.org/u/JHC)\ **Replies:** 3\ **Last updated:** [March 5, 2026, 9:18pm UTC](https://forum.mothur.org/t/trim-seqs-removes-group-membership/22408 "2026-03-05T21:18:52Z")
Hello, I am processing a small dataset (16 samples) using the MiSeq protocol. The sequencing facility left primers attached to the seqs, so I am running trim.seqs after make.contigs. I lose group membership after the t… --- ## [Screen.seqs generating weird result](https://forum.mothur.org/t/screen-seqs-generating-weird-result/22405)
**Author:** [@John\_Kelly](https://forum.mothur.org/u/John_Kelly)\ **Replies:** 7\ **Last updated:** [February 26, 2026, 2:42pm UTC](https://forum.mothur.org/t/screen-seqs-generating-weird-result/22405 "2026-02-26T14:42:22Z")
After aligning my sequences to silva.seed\_v138 I ran summary.seqs: mothur \> summary.seqs(fasta=csp\_bact.trim.contigs.good.unique.align, count=csp\_bact.trim.contigs.good.count\_table) And the results looked fine : Start… --- ## [MiSeq i100 "SOP"](https://forum.mothur.org/t/miseq-i100-sop/22381)
**Author:** [@pad](https://forum.mothur.org/u/pad)\ **Replies:** 8\ **Last updated:** [February 11, 2026, 10:05pm UTC](https://forum.mothur.org/t/miseq-i100-sop/22381 "2026-02-11T22:05:33Z")
Hi all - Illumina is making the MiSeq – acording to their own words – “obsolete”. The MiSeq i100, its replacement, is one of Illumina’s “two-color” (2-channel) instruments. These instruments just use two dyes to identify… --- ## [Remove dominant OTU](https://forum.mothur.org/t/remove-dominant-otu/22400)
**Author:** [@jbailey](https://forum.mothur.org/u/jbailey)\ **Replies:** 2\ **Last updated:** [January 21, 2026, 12:52pm UTC](https://forum.mothur.org/t/remove-dominant-otu/22400 "2026-01-21T12:52:49Z")
I’m analyzing a dataset in which all samples contain the same dominant OTU. I’m curious about comparing the treatments based on the remaining OTUs. After I perform the steps to cluster my samples by OTUs (through class… --- ## [Classify.seqs with Pacbio/long reads not classifying any taxa](https://forum.mothur.org/t/classify-seqs-with-pacbio-long-reads-not-classifying-any-taxa/22396)
**Author:** [@mwinzler](https://forum.mothur.org/u/mwinzler)\ **Replies:** 1\ **Last updated:** [December 16, 2025, 1:45pm UTC](https://forum.mothur.org/t/classify-seqs-with-pacbio-long-reads-not-classifying-any-taxa/22396 "2025-12-16T13:45:27Z")
Hello all, I have four PacBio full length 16S rRNA reads from an environmental sample, targeting Archaea in the dataset. I have made progress using mothur (version 1.48.1, on Mac & while using a HPC cluster on command l… --- ## [Cluster.split in mothur](https://forum.mothur.org/t/cluster-split-in-mothur/22394)
**Author:** [@luo](https://forum.mothur.org/u/luo)\ **Replies:** 1\ **Last updated:** [December 15, 2025, 1:24pm UTC](https://forum.mothur.org/t/cluster-split-in-mothur/22394 "2025-12-15T13:24:39Z")
Hello, I am currently facing an issue where I placed sub.sample after remove.lineage. After running sub.sample, I executed cluster.split(fasta=current, count=current, taxonomy=current, taxlevel=4, cutoff=0.03), and encou… --- ## [16S sequences longer than 251 bp](https://forum.mothur.org/t/16s-sequences-longer-than-251-bp/22387)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 5\ **Last updated:** [December 12, 2025, 7:49pm UTC](https://forum.mothur.org/t/16s-sequences-longer-than-251-bp/22387 "2025-12-12T19:49:36Z")
Hi! I am running a batch of 16s sequences that have been trimmed to get rid of ambigs (R2 only, removed first 20bp). I am using the Miseq sop and I usually don’t get weird numbers when making contigs or aligning but im g… --- ## [Sub.sample in mothur](https://forum.mothur.org/t/sub-sample-in-mothur/22393)
**Author:** [@luo](https://forum.mothur.org/u/luo)\ **Replies:** 3\ **Last updated:** [December 12, 2025, 2:11pm UTC](https://forum.mothur.org/t/sub-sample-in-mothur/22393 "2025-12-12T14:11:35Z")
Hello, I’m currently facing an issue where I placed sub.sample after remove.lineage. After running sub.sample( fasta=stability.trim.contigs.good.unique.good.filter.unique.precluster.pick.pick.fasta, count=stability.tri… --- ## [Analyzing two different runs separately](https://forum.mothur.org/t/analyzing-two-different-runs-separately/22391)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [December 11, 2025, 3:00pm UTC](https://forum.mothur.org/t/analyzing-two-different-runs-separately/22391 "2025-12-11T15:00:48Z")
Hi all, I am analyzing two different sequencing runs that do not align to the same start/end when aligned to the silva database. So running them together using the mothur SOP is not working. I wanted to merge the OTU tab… --- ## [Get sequences from OTUs](https://forum.mothur.org/t/get-sequences-from-otus/22388)
**Author:** [@sje062](https://forum.mothur.org/u/sje062)\ **Replies:** 1\ **Last updated:** [December 5, 2025, 2:01pm UTC](https://forum.mothur.org/t/get-sequences-from-otus/22388 "2025-12-05T14:01:35Z")
Hi mothur forum, I find mothur helpful and thanks for this program. My question is how to get sequences from several of the OTUs from bin.seqs. Just filter the bin.seqs output for sequences belonging to for example 50 O… --- ## [Trimming ambiguous ends16S](https://forum.mothur.org/t/trimming-ambiguous-ends16s/22386)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 3\ **Last updated:** [December 1, 2025, 2:50pm UTC](https://forum.mothur.org/t/trimming-ambiguous-ends16s/22386 "2025-12-01T14:50:28Z")
Hi all, I am using the Mothur Miseq SOP to run all my 16s sequencing data. We send our sequences to a 3rd party sequencer and the last batch they sent had so many ambiguous sequences that mothur completely cut them out. … --- ## [Combining sampling times](https://forum.mothur.org/t/combining-sampling-times/22385)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [November 6, 2025, 1:51pm UTC](https://forum.mothur.org/t/combining-sampling-times/22385 "2025-11-06T13:51:40Z")
I just want to make sure that this workflow for using the Miseq SOP with new data makes sense. Please let me know If I am missing something. My sediment microbiome study has seasonal samples that are sequenced from a 3r… --- ## [Predictive Metagenomics: Rarefied or Raw](https://forum.mothur.org/t/predictive-metagenomics-rarefied-or-raw/22384)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 4\ **Last updated:** [November 1, 2025, 12:49am UTC](https://forum.mothur.org/t/predictive-metagenomics-rarefied-or-raw/22384 "2025-11-01T00:49:05Z")
Continuing the discussion from Rarefaction in mothursop: What about submitting the rarefied results to external software like PICRUSt2? Is this preferential to filtering your OTUs to \>= \ **Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 2\ **Last updated:** [October 30, 2025, 8:57pm UTC](https://forum.mothur.org/t/whats-the-best-experimental-design-for-targeted-metagenomics/22379 "2025-10-30T20:57:20Z") Hey, anyone. I’m curious what you think the best possible experimental design is for an amplicon based study. Mock communities are great (not that I’ve yet had the pleasure of using one) but I’m wondering if spike-ins c… --- ## [Summary.seqs error](https://forum.mothur.org/t/summary-seqs-error/22382)
**Author:** [@kristina](https://forum.mothur.org/u/kristina)\ **Replies:** 0\ **Last updated:** [October 29, 2025, 2:37am UTC](https://forum.mothur.org/t/summary-seqs-error/22382 "2025-10-29T02:37:18Z")
These warnings happened during the first step of our batch: mothur \> fastq.info(file=micycle.txt, pacbio=T) \[WARNING\]: expected a name with + as a leading character, ignoring.\[WARNING\]: missing quality for , ignoring.\[… --- ## [Minimal R relative abundance question](https://forum.mothur.org/t/minimal-r-relative-abundance-question/22375)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 7\ **Last updated:** [October 27, 2025, 1:23pm UTC](https://forum.mothur.org/t/minimal-r-relative-abundance-question/22375 "2025-10-27T13:23:21Z")
Hi all, I am following the minimal R tutorial to analyze the relative abundance of my sediment microbiome samples. I am always confused no matter how many times I do this why in the tutorial the y axis goes to 100 when: … --- ## [Class is missing from the lefse output](https://forum.mothur.org/t/class-is-missing-from-the-lefse-output/22380)
**Author:** [@vherve](https://forum.mothur.org/u/vherve)\ **Replies:** 4\ **Last updated:** [October 23, 2025, 10:32am UTC](https://forum.mothur.org/t/class-is-missing-from-the-lefse-output/22380 "2025-10-23T10:32:46Z")
Dear mothur team, I am currently using mothur 1.48.0 (and 1.48.3 too, but the issue below remains the same) with Ubuntu 24.04. I do have a problem with the Lefse analysis, more specifically with the output. A few years… --- ## [Mixed 16S/ITS kit but reads look overwhelmingly V3–V4 — how to verify and subset per region?](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377)
**Author:** [@OtyLam](https://forum.mothur.org/u/OtyLam)\ **Replies:** 1\ **Last updated:** [October 16, 2025, 1:25pm UTC](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377 "2025-10-16T13:25:59Z")
Hello everyone, I am new to metagenomics bioinformatic analysis, as I’m willing to study soil samples microbial diversity. I have paired-end FASTQs sequenced with a kit that can target three regions (16S V3–V4, 16S V4–V… --- ## [Rarefaction in mothursop](https://forum.mothur.org/t/rarefaction-in-mothursop/22372)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [October 14, 2025, 12:45pm UTC](https://forum.mothur.org/t/rarefaction-in-mothursop/22372 "2025-10-14T12:45:52Z")
Hello! I previously asked when to use the sub sampled data and sadly I am still confused. I was told “Things like amova/homova/pcoa/shannon/simpson/richness are calculated using dist.shared and summary.single using raref… [Next page](https://forum.mothur.org/latest.md?page=1)