# Uncategorized **URL:** https://forum.mothur.org/c/uncategorized/1.md [Latest](https://forum.mothur.org/latest.md) · [Categories](https://forum.mothur.org/categories.md) --- ## [Welcome to the mothur forum](https://forum.mothur.org/t/welcome-to-the-mothur-forum/8)
**Author:** [@system](https://forum.mothur.org/u/system)\ **Replies:** 0\ **Last updated:** [October 10, 2018, 3:23pm UTC](https://forum.mothur.org/t/welcome-to-the-mothur-forum/8 "2018-10-10T15:23:44Z")
This is the discussion forum for the mothur software package. If you have any questions or ideas please post them here and someone from the community will get back to you. This board is open for anyone to respond to othe… --- ## [Working out proceedure for nanopore 16s](https://forum.mothur.org/t/working-out-proceedure-for-nanopore-16s/22154)
**Author:** [@Kendra](https://forum.mothur.org/u/Kendra)\ **Replies:** 12\ **Last updated:** [October 2, 2026, 7:09am UTC](https://forum.mothur.org/t/working-out-proceedure-for-nanopore-16s/22154 "2026-10-02T07:09:01Z")
Creating this thread for my questions that arise when working through nanopore data because that could be useful for others. I’ll write up an SOP if the end result is worth others repeating. Background. I’ve finally got… --- ## [Mothur Silva files](https://forum.mothur.org/t/mothur-silva-files/22449)
**Author:** [@jrthelusmond](https://forum.mothur.org/u/jrthelusmond)\ **Replies:** 1\ **Last updated:** [September 11, 2026, 3:05pm UTC](https://forum.mothur.org/t/mothur-silva-files/22449 "2026-09-11T15:05:29Z")
I am running mothur using silva 132. I downloaded the following files from both silva and rdp to run the program. I feel like some files are missing; can anyone check and let me know if I am missing something? I could no… --- ## [Alpha and beta diversity](https://forum.mothur.org/t/alpha-and-beta-diversity/22448)
**Author:** [@jrthelusmond](https://forum.mothur.org/u/jrthelusmond)\ **Replies:** 1\ **Last updated:** [September 1, 2026, 12:44pm UTC](https://forum.mothur.org/t/alpha-and-beta-diversity/22448 "2026-09-01T12:44:31Z")
Dear All, I have sequencing data from three compost sources and would like to compare their alpha and beta diversity to determine whether any source exhibits greater microbial diversity. I attempted to perform the analy… --- ## [Demultiplexing Minion data](https://forum.mothur.org/t/demultiplexing-minion-data/22446)
**Author:** [@dporco](https://forum.mothur.org/u/dporco)\ **Replies:** 4\ **Last updated:** [August 8, 2026, 3:25pm UTC](https://forum.mothur.org/t/demultiplexing-minion-data/22446 "2026-08-08T15:25:36Z")
Hello I am trying to demultiplex data from a Minion run with an oligo file (dual barcode tagging like “barcode AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT gr1\_rep3”) but I don’t know which command I can feed this … --- ## [AWS EC2 Community mothur AMI - still an option?](https://forum.mothur.org/t/aws-ec2-community-mothur-ami-still-an-option/22437)
**Author:** [@jmcbeth](https://forum.mothur.org/u/jmcbeth)\ **Replies:** 3\ **Last updated:** [July 1, 2026, 3:14pm UTC](https://forum.mothur.org/t/aws-ec2-community-mothur-ami-still-an-option/22437 "2026-07-01T15:14:08Z")
Hey! Just wondering if there should still be mothur AMIs available on Amazon AWS EC2 community. I can’t find it there, wondering if this is still a thing! --- ## [Customizing latest SILVA for V4](https://forum.mothur.org/t/customizing-latest-silva-for-v4/22416)
**Author:** [@Kumari\_Richa](https://forum.mothur.org/u/Kumari_Richa)\ **Replies:** 3\ **Last updated:** [May 21, 2026, 12:07pm UTC](https://forum.mothur.org/t/customizing-latest-silva-for-v4/22416 "2026-05-21T12:07:44Z")
Hi mothur team, I am processing 16S V4 data (515F/806R, ~253 bp reads). I want to customize the full-length latest SILVA v138.2 reference database to create a streamlined V4-only reference file. What are the recommende… --- ## [Make.contigs doesn’t create stability.contigs.count\_table](https://forum.mothur.org/t/make-contigs-doesn-t-create-stability-contigs-count-table/22409)
**Author:** [@Raj](https://forum.mothur.org/u/Raj)\ **Replies:** 7\ **Last updated:** [March 19, 2026, 1:00pm UTC](https://forum.mothur.org/t/make-contigs-doesn-t-create-stability-contigs-count-table/22409 "2026-03-19T13:00:47Z")
Hi, I couldn’t find stability.contigs.count\_table to run commands like summary.seqs(fasta=stability.trim.contigs.fasta, count=stability.contigs.count\_table). I am using version1.48.5. need suggestions/advise please. --- ## [Chimera.vsearch does not update count table](https://forum.mothur.org/t/chimera-vsearch-does-not-update-count-table/22407)
**Author:** [@JHC](https://forum.mothur.org/u/JHC)\ **Replies:** 3\ **Last updated:** [March 8, 2026, 7:31pm UTC](https://forum.mothur.org/t/chimera-vsearch-does-not-update-count-table/22407 "2026-03-08T19:31:52Z")
Hello: I am following the MiSeq SOP using mothur v.1.48.5 (pre-compiled). Everything is going well until I get to the chimera.vsearch step. It appears that the remove.seqs command is not updating the count table that I … --- ## [MiSeq i100 "SOP"](https://forum.mothur.org/t/miseq-i100-sop/22381)
**Author:** [@pad](https://forum.mothur.org/u/pad)\ **Replies:** 8\ **Last updated:** [February 11, 2026, 10:05pm UTC](https://forum.mothur.org/t/miseq-i100-sop/22381 "2026-02-11T22:05:33Z")
Hi all - Illumina is making the MiSeq – acording to their own words – “obsolete”. The MiSeq i100, its replacement, is one of Illumina’s “two-color” (2-channel) instruments. These instruments just use two dyes to identify… --- ## [Remove dominant OTU](https://forum.mothur.org/t/remove-dominant-otu/22400)
**Author:** [@jbailey](https://forum.mothur.org/u/jbailey)\ **Replies:** 2\ **Last updated:** [January 21, 2026, 12:52pm UTC](https://forum.mothur.org/t/remove-dominant-otu/22400 "2026-01-21T12:52:49Z")
I’m analyzing a dataset in which all samples contain the same dominant OTU. I’m curious about comparing the treatments based on the remaining OTUs. After I perform the steps to cluster my samples by OTUs (through class… --- ## [What's the best experimental design for targeted metagenomics?](https://forum.mothur.org/t/whats-the-best-experimental-design-for-targeted-metagenomics/22379)
**Author:** [@brick1233](https://forum.mothur.org/u/brick1233)\ **Replies:** 2\ **Last updated:** [October 30, 2025, 8:57pm UTC](https://forum.mothur.org/t/whats-the-best-experimental-design-for-targeted-metagenomics/22379 "2025-10-30T20:57:20Z")
Hey, anyone. I’m curious what you think the best possible experimental design is for an amplicon based study. Mock communities are great (not that I’ve yet had the pleasure of using one) but I’m wondering if spike-ins c… --- ## [Mixed 16S/ITS kit but reads look overwhelmingly V3–V4 — how to verify and subset per region?](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377)
**Author:** [@OtyLam](https://forum.mothur.org/u/OtyLam)\ **Replies:** 1\ **Last updated:** [October 16, 2025, 1:25pm UTC](https://forum.mothur.org/t/mixed-16s-its-kit-but-reads-look-overwhelmingly-v3-v4-how-to-verify-and-subset-per-region/22377 "2025-10-16T13:25:59Z")
Hello everyone, I am new to metagenomics bioinformatic analysis, as I’m willing to study soil samples microbial diversity. I have paired-end FASTQs sequenced with a kit that can target three regions (16S V3–V4, 16S V4–V… --- ## [Pcr.seqs command error](https://forum.mothur.org/t/pcr-seqs-command-error/22352)
**Author:** [@1234](https://forum.mothur.org/u/1234)\ **Replies:** 1\ **Last updated:** [August 1, 2025, 12:45pm UTC](https://forum.mothur.org/t/pcr-seqs-command-error/22352 "2025-08-01T12:45:26Z")
Hey Pat, While giving the command for pcr.seqs, the main prompt of the website shows that silva.bacteria.fasta should be used as reference (when V4 region was in question), but I visited the ‘blog post’, in which the si… --- ## [Error in reading your fastafile, at position -1. Blank name](https://forum.mothur.org/t/error-in-reading-your-fastafile-at-position-1-blank-name/20231)
**Author:** [@f6mmah](https://forum.mothur.org/u/f6mmah)\ **Replies:** 7\ **Last updated:** [June 13, 2025, 2:33pm UTC](https://forum.mothur.org/t/error-in-reading-your-fastafile-at-position-1-blank-name/20231 "2025-06-13T14:33:27Z")
Hello all, I am a new user in mothur and I do not have any background and I hope you gonna help me. I used this command: mothur \> screen.seqs(fasta=stability.trim.contigs.good.unique.abund.align,count=stability.trim.… --- ## [Inquiry on 16S rRNA Analysis Using Mothur and Data Trimming Techniques](https://forum.mothur.org/t/inquiry-on-16s-rrna-analysis-using-mothur-and-data-trimming-techniques/22333)
**Author:** [@Moh](https://forum.mothur.org/u/Moh)\ **Replies:** 1\ **Last updated:** [June 4, 2025, 4:27pm UTC](https://forum.mothur.org/t/inquiry-on-16s-rrna-analysis-using-mothur-and-data-trimming-techniques/22333 "2025-06-04T16:27:40Z")
I hope this message finds you well. I am currently conducting a meta-analysis involving various studies and am in the process of compiling all the data for 16S rRNA analysis using Mothur. I’m reaching out to seek your ex… --- ## [Chimera vsearch error](https://forum.mothur.org/t/chimera-vsearch-error/22128)
**Author:** [@sje062](https://forum.mothur.org/u/sje062)\ **Replies:** 10\ **Last updated:** [May 9, 2025, 3:35pm UTC](https://forum.mothur.org/t/chimera-vsearch-error/22128 "2025-05-09T15:35:23Z")
Hi, mothur is helpful and it might be obvious but, sorry, I cannot figure out how to make chimera.vsearch work. Please let me know a solution. My command and output with error message is shown below. I use mothur v.1.48… --- ## [Sequence file lost!](https://forum.mothur.org/t/sequence-file-lost/22312)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 5\ **Last updated:** [April 21, 2025, 1:38pm UTC](https://forum.mothur.org/t/sequence-file-lost/22312 "2025-04-21T13:38:40Z")
Hi everyone, I am new to mothur. I went through the entire workflow and was able to get taxonomy for my organisms and relative abundance. I remember their being a file with the actual sequences that helped us know the na… --- ## [Opening count table in R](https://forum.mothur.org/t/opening-count-table-in-r/22319)
**Author:** [@mainly.microbe](https://forum.mothur.org/u/mainly.microbe)\ **Replies:** 1\ **Last updated:** [April 15, 2025, 12:43pm UTC](https://forum.mothur.org/t/opening-count-table-in-r/22319 "2025-04-15T12:43:53Z")
Hi everyone! I am new to mothur and I am still learning how to open the outputs in R to use for downstream analysis. I am currently trying to make a multivariate model using the count table data from mothur. I just am un… --- ## [Peilou's evenness index](https://forum.mothur.org/t/peilous-evenness-index/22315)
**Author:** [@young\_doktor](https://forum.mothur.org/u/young_doktor)\ **Replies:** 2\ **Last updated:** [April 4, 2025, 8:10pm UTC](https://forum.mothur.org/t/peilous-evenness-index/22315 "2025-04-04T20:10:14Z")
Is there a way to calculate Peilou’s index in mothur, and is it the same as Shannoneven? Thanks! --- ## [V138.2 align/tax file issues?](https://forum.mothur.org/t/v138-2-align-tax-file-issues/22313)
**Author:** [@amumford](https://forum.mothur.org/u/amumford)\ **Replies:** 4\ **Last updated:** [March 25, 2025, 1:02pm UTC](https://forum.mothur.org/t/v138-2-align-tax-file-issues/22313 "2025-03-25T13:02:54Z")
First off, thanks for keeping these files updated! 2nd—I think there might be an issue with the 138.2 .tax or .align files: When running classify.seqs using freshly downloaded 138.2 files, everything classifies as ‘unk… --- ## [Primers of the V3-V4 region](https://forum.mothur.org/t/primers-of-the-v3-v4-region/22309)
**Author:** [@1234](https://forum.mothur.org/u/1234)\ **Replies:** 1\ **Last updated:** [March 17, 2025, 2:55pm UTC](https://forum.mothur.org/t/primers-of-the-v3-v4-region/22309 "2025-03-17T14:55:01Z")
How can I design primers of my V3-V4 region concurrently? I am a bit confused where would I get the primer sequence of both regions combined? @pschloss --- ## [Unique.seqs command is not giving required results](https://forum.mothur.org/t/unique-seqs-command-is-not-giving-required-results/22307)
**Author:** [@1234](https://forum.mothur.org/u/1234)\ **Replies:** 4\ **Last updated:** [March 13, 2025, 5:31pm UTC](https://forum.mothur.org/t/unique-seqs-command-is-not-giving-required-results/22307 "2025-03-13T17:31:27Z")
Hey Pat, I was processing my data on mothur and I encountered the problem shown in the picture I renamed my files too then run the unique.seqs command but the error persisted What would be the possible solution? Re… --- ## [Current SILVA reference?](https://forum.mothur.org/t/current-silva-reference/22304)
**Author:** [@James146](https://forum.mothur.org/u/James146)\ **Replies:** 1\ **Last updated:** [February 26, 2025, 3:15pm UTC](https://forum.mothur.org/t/current-silva-reference/22304 "2025-02-26T15:15:02Z")
Dear Team Please could you provide information on the current version of the SILVA-based reference file (this download) in the bullet point list near the top of the MiSeq SOP workflow? I understand that the newest vers… --- ## [Have You Faced Issues Managing Large Data Sets in Mothur?](https://forum.mothur.org/t/have-you-faced-issues-managing-large-data-sets-in-mothur/22276)
**Author:** [@simonas\_rq](https://forum.mothur.org/u/simonas_rq)\ **Replies:** 1\ **Last updated:** [January 14, 2025, 2:31pm UTC](https://forum.mothur.org/t/have-you-faced-issues-managing-large-data-sets-in-mothur/22276 "2025-01-14T14:31:52Z")
I recently started using Mothur as a tool for processing and analyzing microbial data. As someone who’s relatively new to this kind of work, I’ve been diving into it with enthusiasm, but I’ve hit a specific roadblock I n… --- ## [Which version is fit](https://forum.mothur.org/t/which-version-is-fit/22270)
**Author:** [@chunge](https://forum.mothur.org/u/chunge)\ **Replies:** 2\ **Last updated:** [January 11, 2025, 6:56am UTC](https://forum.mothur.org/t/which-version-is-fit/22270 "2025-01-11T06:56:06Z")
just analyse one short protein-coding gene (shourt sequence), the computer system is Win 7, could not install linux system, which version is available? Win\_64 cmd version? where can download the version? --- ## [Greengenes2 database](https://forum.mothur.org/t/greengenes2-database/22166)
**Author:** [@awil](https://forum.mothur.org/u/awil)\ **Replies:** 8\ **Last updated:** [January 6, 2025, 2:01pm UTC](https://forum.mothur.org/t/greengenes2-database/22166 "2025-01-06T14:01:28Z")
Hello, I performed 16S analysis based on greengenes database version gg\_13\_8\_99, but the reviewer suggested the updated database in greengenes2. I’m not sure that can I get the mothur-compatible version of the latest gre… --- ## [Align.seq was successful with the older mothur version but not with v1.48.0](https://forum.mothur.org/t/align-seq-was-successful-with-the-older-mothur-version-but-not-with-v1-48-0/22266)
**Author:** [@YanSun](https://forum.mothur.org/u/YanSun)\ **Replies:** 3\ **Last updated:** [January 6, 2025, 2:00pm UTC](https://forum.mothur.org/t/align-seq-was-successful-with-the-older-mothur-version-but-not-with-v1-48-0/22266 "2025-01-06T14:00:04Z")
I reran the MiSeq SOP today with the same sequences and reference as I did in March/April this year. It was successful back then, but this time I encountered problems with align.seq. The error: \[ERROR\]: template is not … --- ## [Issues with align.seqs: Eliminated bases warning and failed screen.seqs](https://forum.mothur.org/t/issues-with-align-seqs-eliminated-bases-warning-and-failed-screen-seqs/22262)
**Author:** [@fleal174](https://forum.mothur.org/u/fleal174)\ **Replies:** 7\ **Last updated:** [December 16, 2024, 1:48pm UTC](https://forum.mothur.org/t/issues-with-align-seqs-eliminated-bases-warning-and-failed-screen-seqs/22262 "2024-12-16T13:48:36Z")
Hi there, I am quite new to Mothur and have kept coming up with the same issue in my dataset so am looking for some advice. I have a lage dataset (62) of 16s rRNA samples from the V3-V4 region with the following primers… --- ## [Pre.cluster command after demultiplexing is taking too long](https://forum.mothur.org/t/pre-cluster-command-after-demultiplexing-is-taking-too-long/22252)
**Author:** [@shot89\_1000](https://forum.mothur.org/u/shot89_1000)\ **Replies:** 3\ **Last updated:** [December 2, 2024, 1:56pm UTC](https://forum.mothur.org/t/pre-cluster-command-after-demultiplexing-is-taking-too-long/22252 "2024-12-02T13:56:23Z")
Hello, I hope the community can help me with this: I am working with mothur v 1.48.0 with some data I need to first demultiplex and then run the complete mothur pipeline. The demultiplexing itself went well, but the pr… [Next page](https://forum.mothur.org/c/uncategorized/1.md?page=1)